ID: 1034175078

View in Genome Browser
Species Human (GRCh38)
Location 7:149093360-149093382
Sequence CTGTCTTAACAAAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034175076_1034175078 13 Left 1034175076 7:149093324-149093346 CCAAAGCGAGAAGGCAGCAGAGC No data
Right 1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034175078 Original CRISPR CTGTCTTAACAAAAGGAAGC AGG Intergenic
No off target data available for this crispr