ID: 1034179453

View in Genome Browser
Species Human (GRCh38)
Location 7:149126299-149126321
Sequence CCCCAAAGGCAGAGCCGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 249}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034179434_1034179453 22 Left 1034179434 7:149126254-149126276 CCTCCGCTCCGCCCCAACCCAAC 0: 1
1: 1
2: 1
3: 47
4: 580
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179441_1034179453 5 Left 1034179441 7:149126271-149126293 CCCAACTCCCAGGTACAGCCCTG 0: 1
1: 0
2: 1
3: 15
4: 247
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179440_1034179453 9 Left 1034179440 7:149126267-149126289 CCAACCCAACTCCCAGGTACAGC 0: 1
1: 0
2: 2
3: 12
4: 247
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179439_1034179453 10 Left 1034179439 7:149126266-149126288 CCCAACCCAACTCCCAGGTACAG 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179438_1034179453 11 Left 1034179438 7:149126265-149126287 CCCCAACCCAACTCCCAGGTACA 0: 1
1: 0
2: 1
3: 32
4: 288
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179445_1034179453 -3 Left 1034179445 7:149126279-149126301 CCAGGTACAGCCCTGCTGGCCCC 0: 1
1: 1
2: 7
3: 37
4: 312
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179431_1034179453 27 Left 1034179431 7:149126249-149126271 CCTCCCCTCCGCTCCGCCCCAAC 0: 1
1: 0
2: 5
3: 82
4: 912
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179444_1034179453 -2 Left 1034179444 7:149126278-149126300 CCCAGGTACAGCCCTGCTGGCCC 0: 1
1: 0
2: 6
3: 21
4: 230
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179442_1034179453 4 Left 1034179442 7:149126272-149126294 CCAACTCCCAGGTACAGCCCTGC 0: 1
1: 0
2: 2
3: 31
4: 303
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179437_1034179453 14 Left 1034179437 7:149126262-149126284 CCGCCCCAACCCAACTCCCAGGT 0: 1
1: 0
2: 5
3: 65
4: 576
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179433_1034179453 23 Left 1034179433 7:149126253-149126275 CCCTCCGCTCCGCCCCAACCCAA 0: 1
1: 1
2: 0
3: 17
4: 443
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179435_1034179453 19 Left 1034179435 7:149126257-149126279 CCGCTCCGCCCCAACCCAACTCC 0: 1
1: 2
2: 0
3: 66
4: 694
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249
1034179432_1034179453 24 Left 1034179432 7:149126252-149126274 CCCCTCCGCTCCGCCCCAACCCA 0: 1
1: 1
2: 4
3: 98
4: 1039
Right 1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034179453 Original CRISPR CCCCAAAGGCAGAGCCGGCC GGG Exonic
900166569 1:1246408-1246430 ACCCGGAGGCAGAGCCGGCAGGG + Intronic
900439085 1:2644408-2644430 CCCCAACGTCAGAGGCAGCCCGG - Exonic
900461613 1:2804652-2804674 TGCCAAAGGCAGTGCAGGCCTGG - Intergenic
900621823 1:3591049-3591071 CCACAGAGGCAGAGCCTCCCAGG + Intronic
900719695 1:4167309-4167331 CCTCAAGGGCAGAGCCGGGGTGG - Intergenic
901007035 1:6176980-6177002 CCTCAATGCCAGAGCTGGCCAGG + Intronic
901132652 1:6971883-6971905 CCAAAAAGCCAGAGCTGGCCTGG + Intronic
903297038 1:22350558-22350580 CCCTGCTGGCAGAGCCGGCCAGG + Intergenic
904797930 1:33071475-33071497 GCTCAAAGGCAGAGCTTGCCGGG - Intronic
905031412 1:34886342-34886364 CCCCTAAGGCAGAGCACCCCAGG - Intronic
906565724 1:46799754-46799776 CCCCAAAGGCAGGGCTCTCCCGG + Intronic
907043914 1:51288056-51288078 CCCCAAAGGCAGGGCAGGGCAGG + Exonic
908434664 1:64093301-64093323 CCCCAGAGCCAGAGGCAGCCTGG - Intronic
911173322 1:94793928-94793950 CCCCAAAGGCAAAGCCAGGCAGG + Intergenic
911766429 1:101681095-101681117 CCCCAAAAGCACAGCCCTCCAGG - Intergenic
913186435 1:116373791-116373813 CCCCGGAGGCCGAGCGGGCCGGG + Intronic
913526847 1:119701853-119701875 CTGCAAAGGCAGAGCCCTCCTGG + Intronic
913959205 1:143326492-143326514 CACCAAAGGCAGTGCAGCCCCGG + Intergenic
914053522 1:144151872-144151894 CACCAAAGGCAGTGCAGCCCCGG + Intergenic
914125675 1:144814669-144814691 CACCAAAGGCAGTGCAGCCCCGG - Intergenic
915087256 1:153397208-153397230 CCCCAAGAGCAGAGTCGACCTGG + Intergenic
915400363 1:155617449-155617471 CCCCAAAGGCATAGGCGGTCAGG - Intergenic
919942287 1:202296511-202296533 CCCCAAAGGCAGGGGAGCCCCGG - Intronic
920201306 1:204261434-204261456 CCCCACAGGCTGAGCATGCCGGG - Exonic
921888400 1:220329292-220329314 CCCCAAAGGCAGAGGTGTGCTGG - Intergenic
924421087 1:243910864-243910886 CCCCAAGGGGACAGCAGGCCTGG + Intergenic
1063362142 10:5467722-5467744 GAGCAAAGGCACAGCCGGCCTGG - Intergenic
1064033957 10:11900562-11900584 CCAAAAAGTCAGAGCCGGCTGGG + Intergenic
1066052434 10:31648117-31648139 CCCCAGATGCAGTGCAGGCCCGG + Intergenic
1066302364 10:34108256-34108278 GTCCCAAGGCGGAGCCGGCCCGG - Intergenic
1067031916 10:42884118-42884140 GGCCGAAGGCAGAGCCGGGCTGG + Intergenic
1067064133 10:43094163-43094185 CCCCATAGGGACAGCTGGCCTGG + Intronic
1067120484 10:43468382-43468404 CGTGAAAGGAAGAGCCGGCCGGG + Intronic
1067566253 10:47339893-47339915 CCCAACAGGCAGAGCAGCCCGGG - Intergenic
1068523885 10:58106377-58106399 CCCCGCAGGCAGGGCTGGCCAGG + Intergenic
1069819951 10:71221277-71221299 CCCCACTGGCAGAGGCAGCCTGG + Intronic
1071597174 10:86936766-86936788 CCCCAAATGCAGTGCCCGACAGG + Exonic
1073072903 10:100806073-100806095 CCCCCAAGCCAGGGCCAGCCTGG - Intronic
1074819586 10:117168296-117168318 GCCCACAGGCAGAGCCGGGCGGG - Intergenic
1077453071 11:2662555-2662577 CCCCTGAGGCACAGCTGGCCTGG + Intronic
1080638996 11:34147708-34147730 ACCCCAAAGCAGAGCCAGCCGGG - Intergenic
1083953329 11:65968840-65968862 CCCCAGAGGCACAGTGGGCCGGG + Intronic
1084054712 11:66624926-66624948 CCCCATAGGAAGAGGCAGCCTGG - Exonic
1084273571 11:68041011-68041033 CCCCATGGGCAGAGCAAGCCAGG + Intronic
1086243249 11:84720988-84721010 GCCCAAAGGCAGGGCCAGTCTGG - Intronic
1086933770 11:92722394-92722416 CCACAGAGGCAGAGCTGCCCAGG - Intronic
1087877530 11:103375529-103375551 CCACAGAGGCAGAGCTGCCCAGG + Intronic
1090066959 11:123511343-123511365 CCCCAATGGCAGTGCGGGCCCGG + Intergenic
1093126072 12:15330171-15330193 TCCCAAAGGTAGAGCCAGCCTGG + Intronic
1099858995 12:88205384-88205406 CCACAGAGGCAGAGCTGCCCAGG + Intergenic
1100433156 12:94548248-94548270 CCCCCATGGCAGCGCAGGCCTGG + Intergenic
1102146005 12:110655561-110655583 GCCTAGAGGCAGAGCAGGCCAGG - Intronic
1106592667 13:31110766-31110788 CCCACAGGGCAGAGCTGGCCGGG + Intergenic
1112808344 13:103187606-103187628 ATGCAAAGGCAGAGCCAGCCAGG - Intergenic
1113597078 13:111540731-111540753 CCCCAAGGGCAGCCCCGGCCTGG - Intergenic
1113738163 13:112692354-112692376 CTCCAAAGGGTGAGCCGGGCTGG - Intronic
1113831322 13:113297620-113297642 GCCCGCGGGCAGAGCCGGCCGGG - Intronic
1114060086 14:19010224-19010246 CCCCAAAGGCAGCGCACACCTGG - Intergenic
1114060381 14:19011995-19012017 CCCCAAAGGCAGCGCACACCTGG - Intergenic
1114101972 14:19388611-19388633 CCCCAAAGGCAGCGCACACCTGG + Intergenic
1114102460 14:19391547-19391569 CCCCAAAGGCAGCGCACACCTGG + Intergenic
1114416821 14:22550455-22550477 TCCCCAAGGCAGAGCAGGCTGGG - Intergenic
1122417723 14:101558295-101558317 CCCCCACAGCAGAGCCTGCCAGG + Intergenic
1122604541 14:102939507-102939529 TCCCAAAGGCAGTGCCTGCGAGG - Intronic
1122774678 14:104111912-104111934 CCCCATAGGCAGAGGCAGCCGGG + Exonic
1122816121 14:104314912-104314934 CCCCAGAGGCAGGGCTGGGCAGG - Intergenic
1122834692 14:104425032-104425054 CCCCAAGGGCAGAGCCAGTGGGG - Intergenic
1122953493 14:105059132-105059154 CTCCCAGGGCAGGGCCGGCCCGG + Intronic
1202929214 14_KI270725v1_random:23688-23710 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1123423084 15:20147532-20147554 CGCCAAAGGCAGTGCAGCCCCGG + Intergenic
1123532309 15:21154071-21154093 CGCCAAAGGCAGTGCAGCCCCGG + Intergenic
1127981948 15:64041881-64041903 ACCCTCAGGCAGAGCTGGCCTGG + Intronic
1129758468 15:78112732-78112754 CCCCAAAGCCAGATCAGCCCAGG + Intronic
1130546947 15:84863608-84863630 CCCCAAAGCCAGGCGCGGCCCGG - Exonic
1132381480 15:101369467-101369489 CCCAGAAGACAGAGCAGGCCTGG + Intronic
1132597950 16:761771-761793 ATCCACAGGCAGAGCCTGCCTGG - Intronic
1132679594 16:1134296-1134318 CTACCATGGCAGAGCCGGCCAGG + Intergenic
1132802037 16:1759243-1759265 CCCCACAGGCAGGGTCTGCCCGG - Intronic
1132841062 16:1978745-1978767 CCAGAGAGACAGAGCCGGCCAGG - Exonic
1132898146 16:2238514-2238536 GCCCCAAGGCAGAGTCGGCTGGG + Exonic
1134079620 16:11315924-11315946 GCCCTAAGGCAGACCCAGCCGGG - Intronic
1136861668 16:33707813-33707835 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1137248745 16:46727815-46727837 CCCCAATGGCAGGCCCGGCGGGG - Intronic
1137281375 16:46979634-46979656 GCCCTAAGGCAGAGCATGCCTGG + Intergenic
1138561273 16:57802270-57802292 TCCCGAGGGCAGGGCCGGCCCGG + Intronic
1138583955 16:57958581-57958603 GCCAAAAGGCAGAGCCTGCCAGG + Intronic
1140395408 16:74622117-74622139 GCCCAAAGACAAAGCCAGCCAGG + Exonic
1140756973 16:78076352-78076374 CCCCAGAGGCAGGGCAGGCAGGG + Intergenic
1142229602 16:88893690-88893712 CCCCAATAGCAGGGCCAGCCAGG - Intronic
1203123165 16_KI270728v1_random:1555997-1556019 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1142850821 17:2703966-2703988 CTCCAAGGGCAGAGCCAGCGTGG - Intronic
1142875467 17:2849608-2849630 CTCCAAAGGCTGAGGGGGCCTGG - Intronic
1142988443 17:3712410-3712432 ACCCAAAGGCAGAGCAGCCGGGG + Intergenic
1144756512 17:17682936-17682958 CCTGAATGGCGGAGCCGGCCGGG + Intronic
1145249692 17:21290291-21290313 CCCCATACCCAGAGCCGTCCTGG - Intronic
1147390608 17:40106965-40106987 CCACTCAGGCTGAGCCGGCCGGG - Intergenic
1149603826 17:57911005-57911027 CACCAACGGAAGAGCAGGCCAGG + Intronic
1149626342 17:58083318-58083340 CCCCATTGGCTGAGCCCGCCCGG - Intergenic
1150133607 17:62682184-62682206 CCCCCAGGGCAGAGCAGGGCAGG - Intronic
1150445419 17:65224397-65224419 CCCCTCAGGCAGAGCCGGGGTGG - Intronic
1151309862 17:73286356-73286378 CCCCAAAGGCGTCTCCGGCCCGG + Exonic
1151559466 17:74862699-74862721 CCTCCAAGCCAGGGCCGGCCGGG + Exonic
1153040884 18:812236-812258 CAACGACGGCAGAGCCGGCCCGG + Intronic
1157301090 18:46479935-46479957 ACCCAGAGCCAGAGCCTGCCTGG + Intronic
1160199461 18:76784014-76784036 CCCCAACCCCAGAGCTGGCCAGG + Intergenic
1160716746 19:580201-580223 CCCCAAGGACAGAGCCAGGCTGG - Intronic
1161028086 19:2045856-2045878 CCCCAAACGCAGAGCCCCTCTGG + Intronic
1163392293 19:17038092-17038114 CCCAGAAGGCAGAGCTTGCCAGG - Intergenic
1163458873 19:17424617-17424639 CCCCAAAAGCAGAGAAGGCCTGG - Exonic
1163801951 19:19371272-19371294 CCCCACAGCCAGACCAGGCCTGG - Intergenic
1164462940 19:28464173-28464195 CCTCAAAGGCAGAGCTGGAAGGG + Intergenic
1167638054 19:50666745-50666767 CCCCAAAGGCCTGGCCGTCCAGG + Exonic
1168160003 19:54503778-54503800 CCCCAAAGGCAGTGCTGGGTGGG + Intronic
1202692921 1_KI270712v1_random:104295-104317 CACCAAAGGCAGTGCAGCCCCGG + Intergenic
926121529 2:10243636-10243658 CCACACAGGCAGAGCAGGGCTGG + Intergenic
926352285 2:12007092-12007114 ACACAAAGGCAGAGGCCGCCTGG - Intergenic
926750866 2:16197555-16197577 CCCCAGAGCCAGATGCGGCCTGG - Intergenic
928612678 2:33005880-33005902 ATCAAAAGGCAGAGCCGGCCGGG - Intronic
929294409 2:40231089-40231111 GCCCTAAGGCAAAGCAGGCCAGG - Intronic
931284661 2:60821724-60821746 CCCCAAAGGAAGAGAAGGCCTGG - Intergenic
931867282 2:66426335-66426357 CCCCTGAGGAAGAGCCGTCCAGG + Intergenic
932771590 2:74503510-74503532 CCCCAATGGCAGGGCCTTCCAGG + Intergenic
933953480 2:87349672-87349694 CACCAAAGGCAGTGCAGCCCCGG - Intergenic
934237687 2:90245920-90245942 CACCAAAGGCAGTGCAGCCCCGG - Intergenic
934275516 2:91570811-91570833 CACCAAAGGCAGTGCAGCCCCGG + Intergenic
935802620 2:106714132-106714154 CTCCAATGGCAGAACCAGCCTGG + Intergenic
938092303 2:128441662-128441684 CCCCATAGGCAGGGCCACCCAGG + Intergenic
944682593 2:202090830-202090852 GCCCAACGGCAGATCCAGCCAGG + Exonic
945920565 2:215750883-215750905 CCCCAAATGCAAAGGCGGCAGGG - Intergenic
947726199 2:232402435-232402457 CTCCAAAGGCAAAGCCAGTCAGG - Intergenic
948456244 2:238105919-238105941 CCCCGGGGGCAGAGCCAGCCTGG - Intronic
948466868 2:238156484-238156506 GCCCATGGGCAGAGCCGGCGTGG - Intergenic
1169195456 20:3680162-3680184 CCCCTTAGGCACACCCGGCCAGG - Intronic
1170524752 20:17226827-17226849 CCCAGAAGGCGGAGGCGGCCGGG + Intronic
1170875518 20:20246476-20246498 GCCCAAAGGCAGGGCTGGCTGGG - Intronic
1171391759 20:24805998-24806020 ACCCAAGGTCAGAGCCTGCCTGG + Intergenic
1172276988 20:33685361-33685383 CCCCAGAGGCCTGGCCGGCCAGG + Intronic
1173702518 20:45085404-45085426 CCACACAGGCAGGGCCGGACTGG + Intergenic
1174076550 20:47941579-47941601 CCCCTCAGGCAGCGCCAGCCTGG + Intergenic
1174363677 20:50043740-50043762 CAAAAGAGGCAGAGCCGGCCGGG - Intergenic
1174918966 20:54682113-54682135 GCACAAAGTCAGAGCCAGCCAGG - Intergenic
1175260720 20:57672593-57672615 CCCGAAAGACAGAGCCACCCCGG - Intronic
1175404081 20:58715937-58715959 GCTCAAAGCCAGAGCCGGTCTGG - Intronic
1175874656 20:62223680-62223702 CCATGAAGGCAGAGCCGGCATGG + Intergenic
1176238519 20:64065251-64065273 CCCAAGAGGCAGGGCCTGCCTGG + Intronic
1176512805 21:7761451-7761473 CCCCACAGGCAGAGATGGCAGGG + Intronic
1176591234 21:8652287-8652309 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1177614370 21:23498805-23498827 CCACAAGGGCAGAGCTGCCCAGG - Intergenic
1178646918 21:34391975-34391997 CCCCACAGGCAGAGATGGCAGGG + Intronic
1179963716 21:44787480-44787502 GCCCAAAGGCAGGGCAGGCAAGG + Intronic
1180274082 22:10629398-10629420 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1180478567 22:15732836-15732858 CCCCAAAGGCAGCGCACACCTGG - Intergenic
1180478862 22:15734607-15734629 CCCCAAAGGCAGCGCACCCCTGG - Intergenic
1181356149 22:22297512-22297534 CGCCAAAGGCAGTGCAGCCCCGG + Intergenic
1181458232 22:23071272-23071294 CCCTAAAGGCAGAGCCCCCTCGG - Intronic
1181626197 22:24123912-24123934 GCCCACAAGCAGAGCCTGCCTGG + Intronic
1181756411 22:25028101-25028123 CCCCAGAGGCTTCGCCGGCCTGG - Exonic
1182161007 22:28121717-28121739 CCCCATAGGCAGAGGCAGGCAGG - Intronic
1182287899 22:29258957-29258979 CCCCTGAGGCAGACCAGGCCAGG + Exonic
1182743618 22:32587618-32587640 CTCCAAAGGCCGACCAGGCCCGG + Intronic
1183050645 22:35257876-35257898 CCCCGAGGGCGGAGACGGCCCGG - Intronic
1183337076 22:37256048-37256070 CCCCCAAGGCAGAGTGGACCTGG - Intergenic
1184090146 22:42288865-42288887 GCCCAAGGGCAGTGCAGGCCTGG + Intronic
1184477796 22:44730782-44730804 GACCACAGGCAGAGCTGGCCTGG + Intronic
1184781933 22:46654009-46654031 CCCCAAAGGGAGCGTCCGCCTGG - Intronic
1185335484 22:50269370-50269392 GCGCAAAGGCAGAGGCAGCCAGG - Intronic
951030451 3:17875829-17875851 CCCTAAAGGCTGAGCTGGCTGGG + Intronic
951908813 3:27728984-27729006 CCCCGAAGGCCAAGCCGGCCTGG + Intergenic
952239621 3:31516978-31517000 CCACGAAGGAAGAGCCTGCCTGG + Intergenic
953544693 3:43855843-43855865 CCCTAATGGCAGAGCCTGTCAGG - Intergenic
954621964 3:52001597-52001619 CCCCAGAGGGAGATCAGGCCTGG - Intergenic
954801368 3:53188958-53188980 GCCCATAGGCTGAGGCGGCCTGG + Intronic
955661504 3:61304400-61304422 CCACAATGGCAAAGCCTGCCTGG + Intergenic
962279686 3:134040360-134040382 CCCCAAAGGCAGAGTCAACTGGG - Intronic
964358322 3:155870470-155870492 CCCCGCCGGCAAAGCCGGCCGGG - Intergenic
968816610 4:2824787-2824809 CCCCCAAGGCAGGTCCAGCCTGG - Intronic
968909717 4:3471472-3471494 CCCCCAAGGCAGAGGTGGCCCGG + Intronic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969447389 4:7253135-7253157 CCTCAAAGGCCGGGACGGCCAGG - Intronic
969569148 4:7998471-7998493 CCCCACAGGCAGCACCGGCAGGG - Intronic
981784901 4:148466124-148466146 CCCCAAAGCCAGAACTTGCCTGG + Intergenic
985850814 5:2388012-2388034 CCCCAGAAGCAGAGCCGAGCGGG + Intergenic
992052048 5:72950186-72950208 TCTCAAAGGCAGAGATGGCCAGG + Intergenic
993379415 5:87189171-87189193 CCCTAAAGGCAGAGGCAGCATGG + Intergenic
994314131 5:98312819-98312841 CCCCCAAGGCAGGGCTGCCCAGG + Intergenic
996417898 5:123229680-123229702 CACAAAAAGCAGAGACGGCCTGG + Intergenic
1000987986 5:167881804-167881826 CCCCAAATGCAGAGCCACACAGG + Intronic
1001508872 5:172303343-172303365 CCCGAAATGCAGAGCCGGGAAGG + Intergenic
1002313522 5:178328981-178329003 CCCCAAAGCTAGAGCCTCCCGGG - Intronic
1002445199 5:179286411-179286433 TCCCAGAGACAGAGCCGGCACGG + Intronic
1002792749 6:447730-447752 CCCGAAAGGAAGTGCCGGCGAGG + Intergenic
1003568876 6:7242948-7242970 CCTCAAGGGCAGAGGGGGCCAGG - Intronic
1003823327 6:9924855-9924877 GAGCAAAGGCAGAGCAGGCCAGG + Intronic
1004193946 6:13487582-13487604 TCCCAGAGCCTGAGCCGGCCTGG - Intronic
1006448495 6:34092749-34092771 TCTCCAAGGCAGAGCCGACCCGG + Intronic
1006694630 6:35920799-35920821 CCCCAAGGCGCGAGCCGGCCTGG + Intronic
1006990167 6:38208531-38208553 CCCCAAAGGCAGAGCTAGAGAGG + Intronic
1014130299 6:117823385-117823407 CCCCAAGGGCAGAGCCAGCCTGG - Intergenic
1016034919 6:139374935-139374957 GCCCGAAGGTAGAGCCTGCCGGG + Intergenic
1017282185 6:152637032-152637054 GCCCAGAGGCTGAACCGGCCTGG - Intronic
1017766294 6:157609861-157609883 ACCCAGAGGCAGATCCAGCCTGG + Intronic
1018875622 6:167819900-167819922 ACCCAAAGGCAGATCCTGCGAGG - Intergenic
1019341271 7:510231-510253 CGGGAAAGGCAGGGCCGGCCGGG - Intronic
1019350914 7:553562-553584 CCCCACAGCCCCAGCCGGCCTGG + Intronic
1019807644 7:3140010-3140032 CCCGAACGGCAGAGCCCTCCCGG + Intergenic
1020085792 7:5309426-5309448 CCCAAGCGGCAGAGCCTGCCAGG - Intronic
1023746475 7:43327015-43327037 CTCTAAAGGCAGAGCAGTCCTGG - Intronic
1023852153 7:44156580-44156602 CCACAGTGGCAGAACCGGCCAGG + Intronic
1024034374 7:45495162-45495184 CCCCATAGGGAGACCCTGCCCGG + Intergenic
1025208514 7:57007723-57007745 TCCCAAGCGCAGAGCCTGCCAGG + Intergenic
1025663434 7:63569155-63569177 TCCCAAGCGCAGAGCCTGCCAGG - Intergenic
1025860727 7:65325195-65325217 CCCCGAAGGCAGAGGTTGCCGGG - Intergenic
1026976758 7:74503409-74503431 CCCAAAAGGCAGAGCTGGGATGG - Intronic
1031017288 7:116588569-116588591 CCACAAAGGCAGAGCTTCCCTGG + Intergenic
1033256240 7:139804142-139804164 CCACAGAGGCAGAGCTGCCCAGG + Intronic
1034174608 7:149090770-149090792 CCCCAAACGCAGCGCCGGCCGGG + Intronic
1034179453 7:149126299-149126321 CCCCAAAGGCAGAGCCGGCCGGG + Exonic
1034788618 7:153947758-153947780 CTCCAAAGGCAGAGGCAGCCGGG - Intronic
1035401806 7:158570533-158570555 CTTCAGTGGCAGAGCCGGCCGGG - Intronic
1035641630 8:1188934-1188956 CCCCAACCGCGGAACCGGCCTGG - Intergenic
1035641646 8:1188981-1189003 CCCCAACCGCGGAACCGGCCTGG - Intergenic
1035641675 8:1189075-1189097 CCCCAACCGCGGAACCGGCCTGG - Intergenic
1035641718 8:1189216-1189238 CCCCAACCGCGGAACCGGCCTGG - Intergenic
1036563089 8:9914032-9914054 CCCCAGAAGAAGAGCCGGCAGGG + Intergenic
1036746492 8:11413611-11413633 CTCCATAGGCAGAGCAGCCCGGG - Intronic
1037517337 8:19645830-19645852 CCCCCAGGGCAGTGCTGGCCTGG + Intronic
1039412055 8:37363142-37363164 CCCCAAGGCCAGAGCTGGACAGG + Intergenic
1039414996 8:37386138-37386160 CCCCTAAGGGAGGGCTGGCCAGG - Intergenic
1039957466 8:42218281-42218303 CCCGAAGGGCAGAGCTGTCCTGG + Intergenic
1041848575 8:62360107-62360129 ACCCAAAGGGAGAGACTGCCAGG + Intronic
1048852969 8:138662032-138662054 CCCCCAGGGCCCAGCCGGCCGGG - Exonic
1049179211 8:141212448-141212470 CCCCAAGGGCAGAGGCCACCAGG + Exonic
1049273613 8:141708841-141708863 CCCCAAAGACAGAGTCAGCGAGG + Intergenic
1049385482 8:142341035-142341057 CCCTAACTGCAGAGCCCGCCTGG + Intronic
1049761711 8:144334610-144334632 GGCCAGAGGGAGAGCCGGCCAGG - Intronic
1052791554 9:32879714-32879736 CCCCAAAGGGAAAGCTGGCAGGG + Intergenic
1052839562 9:33280316-33280338 CTCCATAGGCAGAGCAGCCCTGG + Intronic
1052985597 9:34484925-34484947 CCCCCAGGGCAGAGGTGGCCAGG + Intronic
1053690613 9:40584935-40584957 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1054301870 9:63385906-63385928 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1054400644 9:64712412-64712434 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1054434251 9:65196728-65196750 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1054496139 9:65824953-65824975 CGCCAAAGGCAGTGCAGCCCCGG + Intergenic
1055030432 9:71768219-71768241 GCCCAACGCCGGAGCCGGCCAGG + Intronic
1055473895 9:76642453-76642475 CCCCAAAGCCAGGCCCTGCCAGG - Intronic
1056632328 9:88304069-88304091 TCCCAAGGGAAGAGCCAGCCTGG - Intergenic
1056654430 9:88497407-88497429 CCCCACAGGCAGTGACTGCCAGG + Intergenic
1056821289 9:89843927-89843949 CCAGAAAGGAAGAGCCTGCCAGG - Intergenic
1059392344 9:114007153-114007175 CCCCAAGGGCACAGCCGGGAGGG - Intronic
1059509368 9:114829774-114829796 CCCCAGAGGCAGAGTTTGCCAGG - Intergenic
1062034548 9:134377102-134377124 CCCCAAAGGCTGAGCAAGACTGG - Intronic
1062182618 9:135198722-135198744 CACCAAAGGGAGAGCAAGCCAGG + Intergenic
1062362538 9:136194455-136194477 CCCCACAGGCAGAGGCCGCTGGG + Intergenic
1062368606 9:136224482-136224504 CCTCACAGGCAGAGCCCCCCAGG + Intronic
1062435510 9:136545157-136545179 CCCCAAACTGAGAGCCGGGCTGG + Intronic
1062472539 9:136712754-136712776 CTCCCCAGGCAGAGGCGGCCGGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1203621263 Un_KI270749v1:131051-131073 CGCCAAAGGCAGTGCAGCCCCGG - Intergenic
1195020225 X:100819685-100819707 CCGGAAAGGCAGACCCTGCCGGG - Intergenic
1196906308 X:120439900-120439922 CCCTAAAGACAGAGCCAGCCTGG - Intronic
1198596982 X:138247195-138247217 TACCAAAGGCAAAGCCAGCCGGG - Intergenic
1200070634 X:153527350-153527372 CCCCGAAGGCAGGGACGGCATGG - Intronic
1200093119 X:153644901-153644923 CCCCCACGGCAGGGCGGGCCGGG + Intronic
1200109501 X:153733198-153733220 GCCCCAAGACAGAGCAGGCCTGG - Intronic
1200697456 Y:6373653-6373675 CGCTACAGGCAGAGCCAGCCTGG + Intergenic
1200921575 Y:8618073-8618095 TGCCACAGGCAGAGCCGGCATGG - Intergenic
1200936374 Y:8741961-8741983 CTCTACAAGCAGAGCCGGCCTGG + Intergenic
1201036657 Y:9791046-9791068 CGCTACAGGCAGAGCCAGCCTGG - Intergenic