ID: 1034180325

View in Genome Browser
Species Human (GRCh38)
Location 7:149132484-149132506
Sequence AAGCTGTTCTCTAGGCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034180325_1034180334 29 Left 1034180325 7:149132484-149132506 CCGCCCGGCCTAGAGAACAGCTT 0: 1
1: 1
2: 0
3: 3
4: 85
Right 1034180334 7:149132536-149132558 ATGGGACCTCTAGACCTCAGTGG 0: 1
1: 1
2: 0
3: 11
4: 102
1034180325_1034180330 10 Left 1034180325 7:149132484-149132506 CCGCCCGGCCTAGAGAACAGCTT 0: 1
1: 1
2: 0
3: 3
4: 85
Right 1034180330 7:149132517-149132539 GAGAGAGAGAGGCACCCGTATGG 0: 1
1: 1
2: 1
3: 35
4: 281
1034180325_1034180331 11 Left 1034180325 7:149132484-149132506 CCGCCCGGCCTAGAGAACAGCTT 0: 1
1: 1
2: 0
3: 3
4: 85
Right 1034180331 7:149132518-149132540 AGAGAGAGAGGCACCCGTATGGG No data
1034180325_1034180329 -1 Left 1034180325 7:149132484-149132506 CCGCCCGGCCTAGAGAACAGCTT 0: 1
1: 1
2: 0
3: 3
4: 85
Right 1034180329 7:149132506-149132528 TTCTCTCTTTCGAGAGAGAGAGG 0: 1
1: 1
2: 5
3: 69
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034180325 Original CRISPR AAGCTGTTCTCTAGGCCGGG CGG (reversed) Intronic
902837756 1:19058002-19058024 GAGCTGGTCTCTGGGCCAGGAGG - Intergenic
908594170 1:65668178-65668200 AAGCTGTTAACTAGACTGGGAGG + Intergenic
909446339 1:75753123-75753145 AAGCTGATCTCTTGCCCAGGAGG - Intronic
910251593 1:85203064-85203086 AAACTCTGCTCTAGGCCAGGCGG + Intergenic
915687920 1:157653975-157653997 AAGCTGCTCTATAGACTGGGTGG + Intergenic
915907438 1:159889099-159889121 AAGCTTCTCTCTAGGCTGGATGG - Intronic
917926889 1:179796865-179796887 AAACTGTTCTCTAGGACAGCAGG + Intronic
923595966 1:235361120-235361142 AAGTCGTTCTCTGGGCCAGGAGG - Intergenic
924457717 1:244231516-244231538 ATGCTGAGCTCTTGGCCGGGGGG + Intergenic
1063950208 10:11214972-11214994 AAGCTGGTATCTAAGCAGGGTGG - Intronic
1068982107 10:63072742-63072764 AAAATCTTCTCTAGGCTGGGTGG - Intergenic
1069735737 10:70652930-70652952 CAGCTGCTCTCTAGGCACGGGGG + Intergenic
1070159259 10:73855740-73855762 AAGCTGTTCTCTCTGCTGGGTGG - Intronic
1071930514 10:90464525-90464547 AAGCTGTGCTCTAGGCAGAATGG - Intergenic
1076858368 10:133128223-133128245 AAGCCACTCGCTAGGCCGGGTGG + Intronic
1077911618 11:6576965-6576987 AAGCTGTTCTGTAGCACGGATGG + Intronic
1079088662 11:17465163-17465185 AGGCTGGTCTCTAGGACTGGAGG + Intronic
1086420574 11:86633676-86633698 ATGCTGTTCTATAGGCCAGAGGG + Intronic
1088932614 11:114367263-114367285 GAGCTGTTCTACAGGGCGGGGGG - Intergenic
1092085103 12:5750589-5750611 AAGCTCTTCTCCAGGGCAGGGGG - Intronic
1096975906 12:55699148-55699170 AAGCTTGTCTCTGGGCCTGGTGG - Intronic
1097264273 12:57736967-57736989 AAGCTTTTCTCTGGGGTGGGCGG - Intronic
1097285355 12:57872999-57873021 AAGCTGTTCTCTCAGGCTGGAGG + Intergenic
1102317809 12:111904246-111904268 AAGATGGTGTCTAGGCAGGGTGG + Intergenic
1102977692 12:117218340-117218362 AAACTGTTCTCTGGGACGTGGGG + Intronic
1110393781 13:75006576-75006598 AAGCTGTAATATAGGCCTGGTGG - Intergenic
1112264643 13:97912313-97912335 CAGCTGTTCTCCAGGGCTGGAGG - Intergenic
1115469661 14:33755568-33755590 AGGCTGCACTCTAGACCGGGTGG + Intronic
1115579395 14:34743340-34743362 AAGAAGTTATCTAGGCTGGGTGG - Intergenic
1115939403 14:38591569-38591591 AAGCTGTGCTCTGGGCTTGGTGG + Intergenic
1120213304 14:81655678-81655700 AAGCTCTTCTCTAGGAGGGCTGG + Intergenic
1120878457 14:89395796-89395818 AAGCTGATCTCTAAGGCTGGAGG + Intronic
1122899814 14:104777792-104777814 AAGCTGTCTTCCAGGCCTGGGGG + Intronic
1123628092 15:22241378-22241400 CAGCTGTTCTCTTGGCTGGCCGG - Intergenic
1125149411 15:36515164-36515186 AAAATGTTTTCCAGGCCGGGCGG + Intergenic
1132624201 16:882523-882545 GAGCTGATAGCTAGGCCGGGAGG - Intronic
1132859836 16:2064723-2064745 AAGCTGTTGGCTGGGCAGGGAGG - Intronic
1132871758 16:2118552-2118574 ATGCTGTTCCCTTGGCCCGGAGG + Intronic
1134520769 16:14918343-14918365 ATGCTGTTCCCTTGGCCCGGAGG - Intronic
1134708441 16:16316994-16317016 ATGCTGTTCCCTTGGCCCGGAGG - Intergenic
1134715656 16:16357027-16357049 ATGCTGTTCCCTTGGCCCGGAGG - Intergenic
1134951161 16:18351651-18351673 ATGCTGTTCCCTTGGCCCGGAGG + Intergenic
1134959101 16:18395132-18395154 ATGCTGTTCCCTTGGCCCGGAGG + Intergenic
1138063925 16:53920843-53920865 GACCAGTTCTCTAGGCCTGGGGG + Intronic
1140128650 16:72138274-72138296 AAGGGGTTCTCTAGTCGGGGAGG - Intronic
1141975852 16:87515956-87515978 CAGCTGTTCTCTTGGCTGGCCGG + Intergenic
1143922995 17:10345705-10345727 AAGCTGTTGGCTAGGCGTGGTGG + Intronic
1144574937 17:16423447-16423469 AAGCTGCTCTCTTGGCCTGCAGG + Exonic
1144814734 17:18026076-18026098 AAGCTGCTCCTTAGGCTGGGAGG - Intronic
1149840970 17:59964711-59964733 AAGCTCTTCTCTCAGCCCGGCGG + Exonic
1161480433 19:4507736-4507758 AAGCTGTTGTGCAGCCCGGGAGG - Intronic
1162336113 19:10061608-10061630 AAGCTGGTCTTGAGGCCGGGAGG - Intergenic
933206562 2:79513444-79513466 GAGCTGTGCTCTAGGGCGAGTGG - Intronic
933806694 2:86003427-86003449 AGCCTCTTCTCTAGGCCTGGTGG + Intergenic
937512428 2:122611369-122611391 GAGCTGTGCTCTAGGCCAGTGGG + Intergenic
944425766 2:199581415-199581437 AAGCTGTTCTCTATTGGGGGTGG + Intergenic
1169913017 20:10662473-10662495 AAGCTGTTCACTCTACCGGGTGG + Intronic
1170759539 20:19237521-19237543 AAGCTGTTCTGCAAGCTGGGTGG - Intronic
1172943592 20:38671478-38671500 ACACTGCTCTCTAGGCAGGGAGG - Intergenic
1176160784 20:63646986-63647008 AAGCTGGTGTGTAGGCCGGGCGG - Intronic
1177509977 21:22074059-22074081 AGGCTCTTCTCTAGACCTGGTGG + Intergenic
1183361755 22:37386543-37386565 AAGCTGGTCTCAGGGCCAGGGGG - Intronic
1184281981 22:43442538-43442560 GAGCTGTTCTCTATGCATGGAGG + Intronic
950056374 3:10027923-10027945 AATCACTTCTTTAGGCCGGGCGG + Intronic
954756834 3:52845239-52845261 AAGCTGTTCTTTCTGCCGGCTGG + Intronic
955315519 3:57935602-57935624 AAGCTATTGACTAGGCCTGGAGG + Intergenic
956679065 3:71761093-71761115 CCGCTGTACTCTAGCCCGGGCGG - Intergenic
968066720 3:195763032-195763054 AAGCTGCGCCCTGGGCCGGGAGG + Intronic
968596929 4:1490549-1490571 CAGCCGTTATCTGGGCCGGGTGG - Intergenic
968769924 4:2498477-2498499 AAACAGTGCTCTAGGCCAGGCGG - Intronic
999820438 5:155222568-155222590 AAGCTCTTCTTTAAGCCGAGAGG + Intergenic
1002546598 5:179950407-179950429 ATGCAGTTATTTAGGCCGGGTGG - Intronic
1017257958 6:152355434-152355456 AAGCTGTACTCTAGGCATTGTGG + Intronic
1018377461 6:163226750-163226772 AACCTGTTCTCTAGGAGGGTTGG + Intronic
1018745308 6:166757403-166757425 AAGCTGTTTTCTGGGCGGAGTGG - Intronic
1019549185 7:1593782-1593804 AAGCTGCTATCCAGGCAGGGTGG + Intergenic
1022260128 7:28695820-28695842 AAACTGTTCCCTAGGTGGGGAGG - Intronic
1032710298 7:134455222-134455244 AAGCTGTTCTATAAGCTGAGGGG - Intronic
1033670860 7:143491348-143491370 AAGCTGTAGTCTAGGAAGGGAGG + Intergenic
1034160476 7:148990735-148990757 AAGCTGTTCTCTGGGCCGGGTGG + Intergenic
1034180325 7:149132484-149132506 AAGCTGTTCTCTAGGCCGGGCGG - Intronic
1039329067 8:36516373-36516395 AAGCTGTCCACTAGGACAGGAGG + Intergenic
1047844680 8:128793239-128793261 ATTCTGTTCTCTAGGCAGTGTGG - Intergenic
1053469533 9:38336370-38336392 AACCTGTCCTGTAGACCGGGAGG + Intergenic
1057182851 9:93039184-93039206 ATGCTGTTCCCTGGGCCCGGGGG + Intergenic
1058105363 9:100964199-100964221 AGGCAGTTCTCCAGGACGGGAGG + Intergenic
1061737090 9:132669254-132669276 AAGCTGTTCTTTGGGGGGGGCGG - Intronic
1190497240 X:51038307-51038329 GAGCAGTTCTCTAGGCAGGCTGG + Intergenic
1190508750 X:51155944-51155966 GAGCAGTTCTCTAGGCAGGCTGG - Intergenic
1200796516 Y:7346038-7346060 AGGCTGTTGTCTAAGGCGGGTGG - Intergenic