ID: 1034188419

View in Genome Browser
Species Human (GRCh38)
Location 7:149196118-149196140
Sequence TCGCGGGCAGTGCTTCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034188413_1034188419 3 Left 1034188413 7:149196092-149196114 CCTTTGCGCCCGGCCGGCGGAGA 0: 1
1: 0
2: 0
3: 17
4: 247
Right 1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG No data
1034188412_1034188419 4 Left 1034188412 7:149196091-149196113 CCCTTTGCGCCCGGCCGGCGGAG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG No data
1034188407_1034188419 18 Left 1034188407 7:149196077-149196099 CCCGGCTTGGGGCTCCCTTTGCG No data
Right 1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG No data
1034188418_1034188419 -10 Left 1034188418 7:149196105-149196127 CCGGCGGAGAGCTTCGCGGGCAG No data
Right 1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG No data
1034188415_1034188419 -6 Left 1034188415 7:149196101-149196123 CCGGCCGGCGGAGAGCTTCGCGG No data
Right 1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG No data
1034188406_1034188419 19 Left 1034188406 7:149196076-149196098 CCCCGGCTTGGGGCTCCCTTTGC 0: 1
1: 0
2: 3
3: 9
4: 181
Right 1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG No data
1034188408_1034188419 17 Left 1034188408 7:149196078-149196100 CCGGCTTGGGGCTCCCTTTGCGC No data
Right 1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG No data
1034188414_1034188419 -5 Left 1034188414 7:149196100-149196122 CCCGGCCGGCGGAGAGCTTCGCG No data
Right 1034188419 7:149196118-149196140 TCGCGGGCAGTGCTTCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034188419 Original CRISPR TCGCGGGCAGTGCTTCCGCC CGG Intronic