ID: 1034189978

View in Genome Browser
Species Human (GRCh38)
Location 7:149206578-149206600
Sequence AGCCACGGAGAGCAAAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034189966_1034189978 26 Left 1034189966 7:149206529-149206551 CCGGGACAGAGAGGACTGACTCC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1034189978 7:149206578-149206600 AGCCACGGAGAGCAAAGGCCGGG 0: 1
1: 0
2: 4
3: 26
4: 257
1034189971_1034189978 5 Left 1034189971 7:149206550-149206572 CCACTGAGATGGACAGTGGGGAC 0: 1
1: 0
2: 3
3: 18
4: 177
Right 1034189978 7:149206578-149206600 AGCCACGGAGAGCAAAGGCCGGG 0: 1
1: 0
2: 4
3: 26
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034189978 Original CRISPR AGCCACGGAGAGCAAAGGCC GGG Intronic
900205625 1:1430936-1430958 AGCCCCGGAGAGCAGAGGCCTGG + Intergenic
901294970 1:8154173-8154195 GGCCACAGAGCGCAAAGGCCGGG - Intergenic
902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG + Intergenic
903022396 1:20403490-20403512 AGCCAGGAAGAGGAATGGCCAGG + Intergenic
903589607 1:24444709-24444731 AGCCAGGGAGAGGAAAGAGCCGG + Intronic
903967827 1:27101098-27101120 AGCCACTGGGAGGACAGGCCTGG - Intronic
904422634 1:30404126-30404148 AGCCAGACAGAGGAAAGGCCTGG + Intergenic
904453581 1:30632630-30632652 AGCCAGTCAGAGCAAAGCCCAGG + Intergenic
905320007 1:37109269-37109291 AGCCACTGAGAGCATAGGGGAGG + Intergenic
906680602 1:47723356-47723378 ACCCACGGAGAGAAGGGGCCTGG - Intergenic
906750056 1:48250815-48250837 ACCCAAGGAGAGGAGAGGCCAGG - Intergenic
907089428 1:51710761-51710783 AGCCAGGGAGAAAAAAGGACAGG - Intronic
911512676 1:98826970-98826992 AGACACGGACAGTGAAGGCCAGG + Intergenic
911532496 1:99061639-99061661 AGACACAGAGAGGAAAGGCAGGG - Intergenic
913113876 1:115679413-115679435 AGCCCCTCAGAGCAAAGTCCTGG - Intronic
913535581 1:119768961-119768983 AGCCACGGTGAGCAGAGGCGGGG - Intergenic
915838443 1:159196844-159196866 AGCTCAGGAGAGCATAGGCCAGG - Intronic
919114882 1:193268773-193268795 ACCAAGGGAGAGCAGAGGCCTGG + Intergenic
919804178 1:201371085-201371107 AGCCATGGGGAGCAAGGGCGGGG + Intronic
920174265 1:204090249-204090271 AGGCAGGGAGAGCATGGGCCTGG + Intronic
922476913 1:225912608-225912630 AGCCAGTGAGGGGAAAGGCCTGG - Intronic
922615217 1:226957134-226957156 AGCCAGGGAGAGCAGGAGCCAGG - Intronic
922615221 1:226957150-226957172 AGCCAGGGAGAGCGGAAGCCAGG - Intronic
922615224 1:226957166-226957188 AGTCAGGGAGAGCAGAAGCCAGG - Intronic
924274164 1:242368374-242368396 AGCCATGGAGATCAAAGACCTGG + Intronic
1063173475 10:3530520-3530542 AGCCGGAGAGAGCAGAGGCCAGG + Intergenic
1063462748 10:6224960-6224982 AGGCGTGGAGAGCAGAGGCCTGG + Intronic
1063951188 10:11224896-11224918 AGCTGGGGAGAGCCAAGGCCAGG + Intronic
1064187005 10:13170625-13170647 AGACAAGGAGAACAAAGACCAGG + Intronic
1064434139 10:15295975-15295997 AACCTCGTAGAGCAAAGGTCAGG - Intronic
1065882600 10:30049309-30049331 AGCCATGGCGAACAATGGCCAGG + Intronic
1067296536 10:44978001-44978023 GGCCACGGAGAGCAGAAGCCGGG + Exonic
1067462398 10:46467340-46467362 AGCGATGGTGAGCAGAGGCCTGG - Intergenic
1067624799 10:47917297-47917319 AGCGATGGTGAGCAGAGGCCTGG + Intergenic
1070340480 10:75493856-75493878 AGTCACGGAGAGTCAAGACCAGG - Intronic
1072217060 10:93296344-93296366 AGCCATGGGGAGCAGGGGCCTGG + Intergenic
1072726113 10:97815238-97815260 CGCCCCTGGGAGCAAAGGCCTGG - Intergenic
1073064966 10:100752858-100752880 AGCCATGGAGAACAAGGGCCAGG + Intronic
1073142807 10:101260372-101260394 AGCCACAGTGGGCAAAGGCTGGG + Intergenic
1073569102 10:104560903-104560925 ATACACGGAGAGCAAAGGTTAGG - Intergenic
1074256264 10:111805631-111805653 AGCGACAGATAGCATAGGCCTGG + Intergenic
1074305280 10:112271250-112271272 AGCGATGGAGCGCAAAGGCCAGG + Intergenic
1074753089 10:116606003-116606025 AGCCAGGGAGACCACAGGTCAGG - Intronic
1075783708 10:125033788-125033810 AGGCACTGAGAGTAAAGCCCTGG + Intronic
1076422397 10:130340633-130340655 AGCCAGGGAACGCCAAGGCCTGG - Intergenic
1076657900 10:132036732-132036754 AGCCTCGGTGAGCAGCGGCCGGG + Intergenic
1076996012 11:297958-297980 AGCAGCAGAGATCAAAGGCCTGG + Intergenic
1077147627 11:1053050-1053072 GGCCACAGAGGGCACAGGCCGGG + Intergenic
1077227574 11:1445108-1445130 GGCCACGGAGGGCCAAGGCAGGG - Intronic
1077674702 11:4185784-4185806 AGCCACGGAAAGGAAACCCCAGG - Intergenic
1078966593 11:16351650-16351672 AGACAGGCAGAGCAAAGGCTAGG - Intronic
1079335898 11:19570204-19570226 AGCCATGCAGAGCAGAGGCAGGG - Intronic
1080896942 11:36455284-36455306 AGCCTGGGAGATCAAAAGCCTGG + Intronic
1081465484 11:43312422-43312444 CGCCACGGTGAGAAAAGGCTGGG - Intronic
1081656882 11:44863246-44863268 ACACAGTGAGAGCAAAGGCCTGG + Intronic
1083713427 11:64562355-64562377 AGTCCCGCAGGGCAAAGGCCAGG - Exonic
1083871350 11:65490304-65490326 AGCCAAAGACAGCAAAGACCAGG + Intergenic
1083897468 11:65627287-65627309 AGCCCAGCAGAGCAGAGGCCAGG + Intronic
1084738261 11:71120216-71120238 AGCCAGGAAAGGCAAAGGCCAGG + Intronic
1085032631 11:73281936-73281958 AGCCAGGGGCAGCAAAGGCATGG - Intronic
1087575198 11:99981326-99981348 AGCCATGGAGTCCGAAGGCCAGG + Intronic
1088480353 11:110291245-110291267 AGCCCCGGAGTTCAAAGCCCTGG + Intronic
1089085785 11:115815760-115815782 AGGGACGGAGAGCACAGGACAGG - Intergenic
1090029846 11:123196641-123196663 AGACTAGGAAAGCAAAGGCCTGG + Intergenic
1090992046 11:131826626-131826648 AGGAAAGAAGAGCAAAGGCCAGG + Intronic
1091601176 12:1918511-1918533 AGGCACGGAAGACAAAGGCCTGG - Exonic
1092242014 12:6841049-6841071 AGCCCAGGAGAGCAGAGCCCAGG - Intronic
1093874084 12:24328530-24328552 ATCCACAGAGAGCAAAAGCTTGG + Intergenic
1095318544 12:40796871-40796893 AGCCAAGGAGACAAAAGTCCTGG + Intronic
1095662632 12:44755513-44755535 AGCCAAGGAGTAAAAAGGCCAGG - Intronic
1096243709 12:49973050-49973072 CTCCACAGAGAGCAAAAGCCAGG + Intronic
1102188853 12:110970613-110970635 AGACTGGGAGAGCAAAGGCCAGG + Intergenic
1102567843 12:113808750-113808772 AGCCAGGGAGAGAACAGGTCGGG + Intergenic
1102923295 12:116808828-116808850 AGCCAGGGGGAGCACAGGACGGG - Intronic
1103377539 12:120469004-120469026 AGCCACGGCGAGCACGGGCCGGG + Intronic
1105307581 13:19180048-19180070 AGCCTCGGAGAGCACAGGGCGGG - Intronic
1106656658 13:31753905-31753927 AGCCACAGAGAGAAAAGGGTGGG + Intronic
1107080517 13:36369836-36369858 AGCCATGGAGATCGCAGGCCTGG + Intronic
1109780604 13:67106609-67106631 CTCCACGGAGTGCAAAGCCCTGG - Intronic
1110119963 13:71867455-71867477 AGGGACGGAGAGGAAAAGCCGGG + Intergenic
1111676943 13:91399252-91399274 AGCCTGGGGGAGCGAAGGCCGGG - Intronic
1111857841 13:93662126-93662148 AGCCTTGGAGAGCACAAGCCTGG - Intronic
1112696155 13:101950667-101950689 ACCTGCTGAGAGCAAAGGCCTGG - Intronic
1113064396 13:106358788-106358810 AGCCTCGCAGAGCAAAGGGCAGG + Intergenic
1113415248 13:110123783-110123805 AGACACAGAGGGCAAAGCCCTGG - Intergenic
1113808742 13:113124487-113124509 AGCCCCGGAGAGCCAGGGCCAGG + Intronic
1113908308 13:113830470-113830492 AGCCACGGGGAGGAGGGGCCCGG - Intronic
1113908336 13:113830545-113830567 AGCCACGGGGAGGAGGGGCCCGG - Intronic
1116340909 14:43722323-43722345 AGCCACCGCGCCCAAAGGCCAGG + Intergenic
1117758976 14:59006193-59006215 AGCCTAGGAGAGGAAAGGGCAGG + Intergenic
1119615964 14:76099418-76099440 AGCCACGCTTAGCAAGGGCCGGG - Intergenic
1120749557 14:88185573-88185595 ACCCACGGACACCAAAGACCGGG - Exonic
1122037508 14:98959590-98959612 AGCCAGGAAGGTCAAAGGCCAGG + Intergenic
1122112388 14:99511549-99511571 AGCCACAGACTGCGAAGGCCTGG - Exonic
1122598895 14:102911566-102911588 AGCCACTGAGAGGACAGCCCGGG - Intergenic
1125518674 15:40336605-40336627 AGCCACAGGCAGCAAAGCCCGGG - Exonic
1126437310 15:48648422-48648444 TGCCGGGGAAAGCAAAGGCCAGG - Intergenic
1127790179 15:62391810-62391832 AGCCTCGGAGCCCCAAGGCCGGG - Intronic
1132235423 15:100216569-100216591 AGGCAAGGAGAGCAAAGGTAAGG - Intronic
1132671774 16:1104925-1104947 AGCCACGGAGAGGAGCAGCCTGG - Intergenic
1137444662 16:48524365-48524387 AGCCAATGTGAGCCAAGGCCTGG - Intergenic
1137463202 16:48684828-48684850 AACCAAGGAGAGCAAAGTACAGG - Intergenic
1137530691 16:49277085-49277107 AGCCACGGAGACCAGAACCCTGG + Intergenic
1140097331 16:71885443-71885465 ACCCTCGGAGAGTAAAGGCCAGG - Intronic
1141760144 16:86022827-86022849 AGCCACTGAGCTCCAAGGCCTGG - Intergenic
1141929446 16:87192107-87192129 AGCCAGGGTGAGAAAAGGTCTGG + Intronic
1143946060 17:10593496-10593518 TGCCACTGAGAGGAAAGGCCAGG - Intergenic
1143951177 17:10633534-10633556 AGCCATGGTGAGCCACGGCCAGG - Intronic
1144705076 17:17362858-17362880 AGCCACTAAAAGGAAAGGCCAGG - Intergenic
1145287161 17:21514414-21514436 AGCCACAGAGATCAAGGGCGAGG - Intergenic
1145390463 17:22451937-22451959 AGCCACAGAGATCAAGGGCATGG + Intergenic
1145789713 17:27618621-27618643 AGCCACGGACAGCATAAACCAGG + Intronic
1145940404 17:28740639-28740661 AGCCAAGGAGAGCCAGGGGCAGG - Intronic
1146315781 17:31805777-31805799 AGCCACAGAGACCACAGCCCTGG - Intergenic
1146705169 17:34995983-34996005 TGCCATGGAGGGCAAAGCCCGGG - Intronic
1147875962 17:43620748-43620770 AGGCAATGAGAGGAAAGGCCAGG - Intergenic
1152888724 17:82867849-82867871 AGGCACTGAGGGTAAAGGCCAGG - Intronic
1155146963 18:23092329-23092351 AGTCCCGGAGTCCAAAGGCCAGG + Intergenic
1157183522 18:45518836-45518858 CTCCCTGGAGAGCAAAGGCCAGG + Intronic
1157504790 18:48218674-48218696 GGCCAAGGAGAGCAGAGTCCAGG - Intronic
1158732287 18:60037553-60037575 AGCCACTGTGAGGAAAGGCATGG + Intergenic
1161011503 19:1961462-1961484 AGAAACGGACAGCAATGGCCTGG - Intronic
1161585598 19:5103800-5103822 AGCCTCACAGAGCAAAAGCCAGG - Intronic
1162465708 19:10838600-10838622 AGCCACGAAGAACAAGGACCAGG + Intronic
1163634880 19:18433250-18433272 AGCCAGGGAGCGCACGGGCCCGG - Intronic
1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG + Intronic
1166888139 19:45973634-45973656 AGCCCCGGAGAGGGAAGGCGGGG + Intergenic
1167030788 19:46958599-46958621 AGCAACAGAGAGCAACTGCCTGG - Intronic
1167220060 19:48193477-48193499 AGCCACATAGGGCAGAGGCCAGG + Intronic
1167718067 19:51156980-51157002 AGTAGCTGAGAGCAAAGGCCAGG - Intergenic
925267621 2:2577556-2577578 AGCCACAGAGACCAAGGCCCAGG - Intergenic
926257265 2:11216690-11216712 AGAAACGGAGAGCTATGGCCTGG - Intronic
927200234 2:20573598-20573620 AGCCTCTGGAAGCAAAGGCCCGG - Intronic
927471895 2:23383913-23383935 AGCCAAGGAGAGCAGAGGCCTGG + Intergenic
928704754 2:33936527-33936549 AGAAATGCAGAGCAAAGGCCGGG - Intergenic
929756223 2:44767933-44767955 AGCTCAGGAGAGCAAAGGCTTGG + Intronic
931775093 2:65533334-65533356 AGCCAGGGAGAGAAACGGCAGGG + Intergenic
931808155 2:65827893-65827915 AGCCACTGAGAACATAGGCAGGG - Intergenic
932490052 2:72114677-72114699 AGCTATGGAGAGCAAAGGCCTGG - Intergenic
932991182 2:76789773-76789795 AGTCACAGAGAACAAAGGCATGG + Intronic
933776178 2:85772473-85772495 CGCCACGGAGGGCAGAGGGCAGG + Intronic
935854260 2:107257770-107257792 AGCCACAGAGAGAAACAGCCAGG + Intergenic
936984210 2:118292631-118292653 AGCCAAAGAGAGCAAAGTTCTGG - Intergenic
937525596 2:122765121-122765143 AGCCACTGAGAACAAAGGAGTGG - Intergenic
942080397 2:172394830-172394852 AGCCACTGAGACCAAAAGTCAGG + Intergenic
942492952 2:176508180-176508202 AGCCACAGGGAGCAATGGCCTGG - Intergenic
942703421 2:178739977-178739999 AGCCACTCAGAGAAAAGACCTGG + Exonic
945966266 2:216190584-216190606 AGGAACAGAAAGCAAAGGCCAGG - Intronic
946027788 2:216682320-216682342 AGCCATGGAGATTAAAGGGCTGG + Intronic
946081283 2:217120837-217120859 AGCCACGGTGAAGACAGGCCAGG + Intergenic
947265424 2:228274341-228274363 AGGCACCCAGAGCCAAGGCCAGG - Intergenic
947541363 2:230982044-230982066 AGGCACGGAAAGGAGAGGCCTGG + Intergenic
947618556 2:231574189-231574211 AGACAGGGAGAGCAGAGCCCTGG + Intergenic
947826224 2:233107691-233107713 AGCCCTGGACAGCAAGGGCCTGG + Intronic
948375111 2:237516091-237516113 AGGCACAGAGAGCAAGGGGCAGG + Intronic
948871156 2:240798926-240798948 ATCCAAGTAGAGCAAAGGCTGGG + Intronic
1169146478 20:3255820-3255842 AGCCACTGAGAGCAAACTCCAGG - Intronic
1169204007 20:3730104-3730126 AGCCACGGAGAGTATAGGAGTGG + Intergenic
1170366351 20:15602264-15602286 AACCCAGGAGAACAAAGGCCTGG + Intronic
1172843192 20:37914565-37914587 AGCCAGGGAGAGAAAAGGTCTGG - Intronic
1172931523 20:38589504-38589526 AGGCCAGGAGACCAAAGGCCAGG - Intergenic
1173028850 20:39335769-39335791 AGACAAGGAGAACAAAGCCCAGG - Intergenic
1173724995 20:45291171-45291193 GGGCACTGAGGGCAAAGGCCAGG - Intergenic
1174049625 20:47758666-47758688 GACCACGGAGAGCAAAGAGCAGG - Intronic
1174253819 20:49239158-49239180 AGCCACGGGCTGCAAATGCCTGG - Intronic
1174420250 20:50394711-50394733 GGACACGGAGAGCAAACACCGGG - Intergenic
1174563362 20:51446849-51446871 AGTCACAGAGGGCAAAGGTCCGG + Intronic
1175301577 20:57946956-57946978 AGACACTGAGTGCAAGGGCCGGG + Intergenic
1175859483 20:62142852-62142874 CGCCCCGGCGAGCAGAGGCCGGG - Intronic
1178427668 21:32491933-32491955 AACCACTGAGAGCCGAGGCCAGG - Intronic
1179799647 21:43804917-43804939 GGCCAAGGAGAGGGAAGGCCAGG + Exonic
1179801696 21:43814308-43814330 AGCAGCGGAGAGAAAAGGACAGG - Intergenic
1180198095 21:46209272-46209294 AGCCACTGTGTGCAAGGGCCAGG - Intronic
1180922579 22:19528772-19528794 AAGCATGGAGAGGAAAGGCCGGG + Intergenic
1181168371 22:20995095-20995117 AGCCATGGAGAGCACCTGCCAGG + Intronic
1181764197 22:25079570-25079592 AAGCAGGGAGAGCATAGGCCAGG + Intronic
1181989368 22:26825618-26825640 AGCCCAGAAGTGCAAAGGCCGGG - Intergenic
1181997540 22:26894486-26894508 AGCCAGGGAAAGCATAGGCCAGG - Intergenic
1183986624 22:41573849-41573871 AGCCAGTGAGAGGAGAGGCCTGG - Intronic
1184093055 22:42302357-42302379 AGCCATGGACAGCAAAGGGCGGG + Intronic
1184192137 22:42901917-42901939 CACCACGGAGAGGAAGGGCCAGG - Intronic
1184251947 22:43265609-43265631 TGCAACGGAGAGCAAGGGACGGG + Intronic
1184285390 22:43468174-43468196 ATCCACGGCTAGCAAATGCCAGG + Intronic
1184535187 22:45082009-45082031 TGTCAGGGAGAGCAAGGGCCAGG + Intergenic
1184587930 22:45460372-45460394 AGCCACAGCGAGCACAGGCTGGG - Intergenic
1185226429 22:49656384-49656406 AGCCCCGGAGAGGCAGGGCCTGG + Intronic
950468297 3:13168740-13168762 AGCCACTGAAATCAAAAGCCAGG - Intergenic
950547138 3:13645196-13645218 AGACACAGAGGGCAAAGTCCAGG + Intergenic
952388592 3:32860759-32860781 AGCCACGCAGAGCCCAGGCCAGG - Intronic
953465563 3:43116394-43116416 AGCCACATAGAGCAAAGGCCAGG + Intergenic
954635853 3:52070430-52070452 AGCCAGGGAGGGCAGAGGTCTGG + Intergenic
954717353 3:52533372-52533394 GGCCCCGGAGCGCAAGGGCCGGG - Intronic
956553368 3:70488082-70488104 AGCCACGGAGGGGAAGGGCTCGG - Intergenic
956782827 3:72617829-72617851 ATTAACAGAGAGCAAAGGCCAGG - Intergenic
958260482 3:91374809-91374831 AGTCACTGAGAGCAAAGGATGGG - Intergenic
962892935 3:139688662-139688684 AGCCAAGGAGAGCAAGGGAGGGG - Intergenic
964554156 3:157917444-157917466 AGCCAGGAAGAGCAAAGGTAGGG + Intergenic
965344655 3:167533770-167533792 AGCCACTGAGAACAATGGTCTGG - Intronic
968428401 4:537843-537865 AGCCACGAAGGGCCAAGGACGGG - Intronic
972075252 4:35079243-35079265 AGCCAGGGAGAGCCTAAGCCTGG + Intergenic
975174161 4:71268318-71268340 AGTCACAGAAAGAAAAGGCCTGG - Intronic
976500842 4:85787243-85787265 ATATATGGAGAGCAAAGGCCTGG - Intronic
977862931 4:101988004-101988026 AACCATGAAGAGCAGAGGCCTGG + Intronic
978587677 4:110291637-110291659 AGCAACAGAGAATAAAGGCCTGG + Intergenic
981995270 4:150967400-150967422 AGGGAGGGAGAGCAAAGGCAAGG - Intronic
985678606 5:1244733-1244755 AGCCACTGAGATACAAGGCCTGG + Exonic
987707444 5:21474002-21474024 AGCCATGGAGAGCCAAGGAGAGG - Intergenic
989105799 5:37861964-37861986 TGCCGTGGAGAGAAAAGGCCTGG + Intergenic
990771942 5:59257371-59257393 AGCCACACATATCAAAGGCCAGG - Intronic
991559638 5:67936081-67936103 AGCCACAGAGGGCAAAGGTACGG - Intergenic
997688980 5:135812844-135812866 AGACACAGACAGCAAAGGACAGG - Intergenic
997893227 5:137693711-137693733 AGCAGCTGAGAGCAAAGGCCTGG - Intronic
998502658 5:142646785-142646807 AGAAAAGGAGAGAAAAGGCCGGG - Intronic
999992299 5:157060677-157060699 AGCCACAGAGAGCCAAGACAGGG + Intergenic
1002170142 5:177370392-177370414 AGCCCAGGAAAGCCAAGGCCAGG - Intronic
1002307784 5:178293908-178293930 GGCCACGGAGTCCAGAGGCCAGG + Intronic
1002335877 5:178478041-178478063 AGCCTCGGAGAGAACAGGCAGGG + Intronic
1004177639 6:13354010-13354032 AGTCCAGGAGAGCAGAGGCCAGG + Intergenic
1005762490 6:28980188-28980210 AGCCACAGAGATCAAGGACCTGG - Intergenic
1006377515 6:33679812-33679834 AGCAACGGAGAGGAGAGCCCAGG + Intronic
1006455153 6:34127627-34127649 AGGCAGGGAGAGGAAAGACCAGG + Intronic
1006456846 6:34136907-34136929 AGCCACTGAGAGCAGAGGCAGGG + Intronic
1007312076 6:40954700-40954722 ATGCACGGAGAACAGAGGCCTGG + Intergenic
1007954323 6:45902419-45902441 AGCCAGGGACAGCATGGGCCAGG + Exonic
1009183279 6:60544360-60544382 AGTCACTGAGAGCAAAGGATGGG + Intergenic
1009537565 6:64908459-64908481 TGCCAGGGAGGGCAAAGGGCTGG + Intronic
1010107126 6:72182851-72182873 AGCCCCGGAGCTCAAAGCCCAGG + Exonic
1012847418 6:104408163-104408185 AGACACAGAGAACAAAGACCTGG + Intergenic
1017717838 6:157224590-157224612 AGCCACGGGGATGAAAGGCCTGG - Intergenic
1018314259 6:162541369-162541391 AGACAGGGAGGGCAAAGGCAGGG + Intronic
1018767631 6:166946246-166946268 AGGCTCAGAGAGCACAGGCCTGG - Intronic
1019133940 6:169896743-169896765 AGCCACAGAGGTCAAAAGCCTGG - Intergenic
1019414401 7:920676-920698 AGCCCCCGAGAGTAAAGCCCGGG + Intronic
1019639173 7:2094042-2094064 GGCCAAGGAAAGCAGAGGCCAGG + Intronic
1020654785 7:10916461-10916483 AGCCACAGAGAACAAAGAACTGG + Intergenic
1022993894 7:35734020-35734042 AGGAACGGTGAGCAAGGGCCCGG + Intergenic
1024658157 7:51469590-51469612 ATCCACAGAGATCAAGGGCCAGG - Intergenic
1024969126 7:55052696-55052718 AACCACTGTGAGCAAAAGCCTGG - Intronic
1026844873 7:73693176-73693198 AGCCACGTAGAGAAAAGTACAGG - Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029490782 7:100868774-100868796 AGCCAGAGAGAGCCAGGGCCAGG + Exonic
1029620059 7:101684791-101684813 AGCCCCGGGGAGCAACAGCCAGG + Intergenic
1030203607 7:106930517-106930539 GGCTAAGAAGAGCAAAGGCCAGG - Intergenic
1030427001 7:109390760-109390782 AGCCATGGAGAACAAATTCCAGG - Intergenic
1031966411 7:128031142-128031164 CGCCTGGGAGAGCCAAGGCCCGG + Intronic
1032000947 7:128265011-128265033 AGGCACAGAGAGAAAAGGCAAGG - Intergenic
1032085101 7:128879702-128879724 AGTCACGGTGAGCAAAGCCGAGG - Exonic
1032458804 7:132094147-132094169 GGCCAGTGAGTGCAAAGGCCGGG - Intergenic
1032490068 7:132317912-132317934 AGCCAGGCAGAGCAAGGGTCGGG + Intronic
1033044303 7:137947489-137947511 AGCCCCGGAGGGCACAGGCCAGG - Intronic
1034063923 7:148118727-148118749 GGCCACGGAGACCACAGGACTGG + Intronic
1034189978 7:149206578-149206600 AGCCACGGAGAGCAAAGGCCGGG + Intronic
1034442335 7:151092276-151092298 AGCCTGGGAGAGCCAAGGCTGGG + Intronic
1034469076 7:151246148-151246170 AGCCGCAGAGAGCAAAGCCCTGG - Intronic
1035227912 7:157443674-157443696 AGCCACGGAGGGCCAGGGTCCGG - Intergenic
1035464441 7:159065350-159065372 AGCCACGGAGGGCCAGAGCCTGG - Intronic
1036217457 8:6892470-6892492 AGCCACAGAGAGGGAAGGCTTGG + Intergenic
1037940220 8:22945609-22945631 ATCCACGTGGAGCAAAGACCTGG - Intronic
1038273264 8:26094865-26094887 AGCCCCGGAGAGCATGGACCTGG - Intergenic
1038417644 8:27408956-27408978 AGCCAGGGAGAGGAAAGGACGGG - Intronic
1038464520 8:27748959-27748981 AGCAACGGAAAGCCATGGCCTGG + Intronic
1038531361 8:28320359-28320381 AGCCACACAGAGCAAGTGCCAGG + Intronic
1042151445 8:65790219-65790241 AGCCCTGGGGAGCAGAGGCCAGG + Intronic
1044572646 8:93736904-93736926 AGACACAGAGAACAAAAGCCAGG + Intronic
1047201695 8:122772725-122772747 AGCCAAGGAGAGGGAAGGCAGGG + Intergenic
1048209934 8:132446414-132446436 AGCCAAGGAGAGCAGAGTCCGGG - Intronic
1048964344 8:139604489-139604511 CGCCATGGAGAGCACAAGCCGGG + Intronic
1048996027 8:139794179-139794201 AGCTCCTGAGAGCAGAGGCCTGG + Intronic
1049005715 8:139854430-139854452 AGACACGGACACCAAGGGCCTGG - Intronic
1049356385 8:142190867-142190889 AGCCACAGAGAGCCAGAGCCAGG - Intergenic
1049624036 8:143612163-143612185 AGCCACAGAGAGGAGGGGCCAGG + Intergenic
1053351320 9:37415128-37415150 ACAAACGGTGAGCAAAGGCCTGG - Intergenic
1053463565 9:38288936-38288958 AGTCAAGGAGAGAAAAGGCTGGG + Intergenic
1056576439 9:87858789-87858811 AGCAACGGAGGTCAAAGACCAGG - Intergenic
1056577820 9:87869334-87869356 AGCCATGGAGGGCTGAGGCCCGG + Intergenic
1057180787 9:93028954-93028976 AGCCATGAAGAGCTGAGGCCAGG - Intronic
1057458548 9:95237454-95237476 AGCCACTGTGAGCAAAGACTCGG - Intronic
1059305740 9:113351690-113351712 AGAAACGGAGAGCAAAAGCAGGG + Intronic
1060555119 9:124504204-124504226 AGCCCCGGAGAGACGAGGCCGGG + Intronic
1061087727 9:128409159-128409181 AGCCGCCCAGAGCAGAGGCCTGG + Intergenic
1061678101 9:132229597-132229619 AGCCACAGTAAGCAAGGGCCAGG - Intronic
1188646634 X:32576699-32576721 AGCCAAGGAGAGCAAAACCATGG + Intronic
1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG + Intergenic
1192367488 X:70486237-70486259 AGCCAGGGAGAGCCAGAGCCTGG - Intronic
1192965784 X:76175225-76175247 ATCCACGGAGGGCAATAGCCAGG + Intronic
1193556467 X:82960332-82960354 AGACAGGGAGAGGCAAGGCCTGG + Intergenic
1195658326 X:107354390-107354412 AGACAGAGAGTGCAAAGGCCTGG - Intergenic
1201143007 Y:11044126-11044148 AGCCAGGAAAGGCAAAGGCCAGG + Intergenic