ID: 1034192370

View in Genome Browser
Species Human (GRCh38)
Location 7:149222240-149222262
Sequence ACAGGCCCTCCTTGCACTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034192370_1034192374 -1 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192374 7:149222262-149222284 TTATGGTGCTGCCAAGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 121
1034192370_1034192379 15 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192379 7:149222278-149222300 GTCCAGGTGGGTCAGGTGCCAGG No data
1034192370_1034192376 3 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192376 7:149222266-149222288 GGTGCTGCCAAGGTCCAGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 218
1034192370_1034192382 19 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192382 7:149222282-149222304 AGGTGGGTCAGGTGCCAGGGTGG No data
1034192370_1034192375 2 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192375 7:149222265-149222287 TGGTGCTGCCAAGGTCCAGGTGG No data
1034192370_1034192383 20 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192383 7:149222283-149222305 GGTGGGTCAGGTGCCAGGGTGGG No data
1034192370_1034192380 16 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192380 7:149222279-149222301 TCCAGGTGGGTCAGGTGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 246
1034192370_1034192372 -7 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192372 7:149222256-149222278 GGCCTGTTATGGTGCTGCCAAGG 0: 1
1: 0
2: 1
3: 12
4: 112
1034192370_1034192377 8 Left 1034192370 7:149222240-149222262 CCACGAGTGCAAGGAGGGCCTGT No data
Right 1034192377 7:149222271-149222293 TGCCAAGGTCCAGGTGGGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034192370 Original CRISPR ACAGGCCCTCCTTGCACTCG TGG (reversed) Intronic