ID: 1034202388

View in Genome Browser
Species Human (GRCh38)
Location 7:149290523-149290545
Sequence GGCACTGTGTAAGGTGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034202388 Original CRISPR GGCACTGTGTAAGGTGCTAG AGG (reversed) Intronic
902077560 1:13800124-13800146 GGCACTGTTTTAGGTGCCAGGGG + Intronic
902557674 1:17256547-17256569 GGCTCTGTGTGAGATGCTGGGGG - Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903948967 1:26982992-26983014 GCCACTGTGCAAGGTGCTAGAGG - Intergenic
904833443 1:33320259-33320281 GGTACTGCGTAAGGTACTACAGG + Intronic
905710438 1:40097605-40097627 GGCACTGAGTAAGGTGCCCAAGG + Exonic
906253793 1:44332047-44332069 AGCTCTGTGTTAGATGCTAGGGG - Intronic
907846982 1:58217811-58217833 GGCTCTGTGTTAGGTACTATGGG - Intronic
908767067 1:67563832-67563854 GGCACTCTGCTAGGTGCTTGGGG - Intergenic
911118306 1:94269719-94269741 GGCATTGTTAAAGGTGCTGGGGG + Intronic
911445422 1:97985981-97986003 GGCTCTGTGCTAGGTGCTGGGGG + Intergenic
911564558 1:99448225-99448247 GGCACTGTGCCAGGCACTAGGGG - Intergenic
912448316 1:109753711-109753733 GGCCCTGTGTAATGGGCGAGGGG - Intronic
912506571 1:110160883-110160905 GGCAATGTGTAGGATGCCAGCGG + Intronic
913563714 1:120049128-120049150 GGCACTGCTTAAGTTGCGAGGGG - Intronic
913634410 1:120744435-120744457 GGCACTGCTTAAGTTGCGAGGGG + Intergenic
914284307 1:146208502-146208524 GGCACTGCTTAAGTTGCGAGGGG - Intronic
914545339 1:148659243-148659265 GGCACTGCTTAAGTTGCGAGGGG - Intronic
914621229 1:149411431-149411453 GGCACTGCTTAAGTTGCGAGGGG + Intergenic
914782248 1:150796175-150796197 GATACTGTGTTAGGTGCTGGAGG - Intergenic
915283570 1:154838824-154838846 GGCACTGTGCAAGGTGCTGGGGG - Intronic
915968777 1:160336915-160336937 GGCACTGTGTTAGGTGGTAAGGG - Intronic
916906290 1:169288276-169288298 GACATTGTTTTAGGTGCTAGGGG - Intronic
917224612 1:172768253-172768275 GGCACTGTGTGAGGTCCTGAAGG - Intergenic
917694563 1:177508625-177508647 GGGACTATGCAAGGTGCTAGAGG - Intergenic
918354124 1:183689848-183689870 GGCACTGTGCCAGGTGCTGTGGG + Intronic
919844351 1:201631893-201631915 GGCACTGTGCTAGGTGATGGGGG - Intronic
919958412 1:202441105-202441127 GGCACTGTGCTAGGAACTAGGGG - Intronic
920191118 1:204194506-204194528 GGTGCTGTGCTAGGTGCTAGGGG + Intronic
920673362 1:208021754-208021776 GGCACTGTGGTAAGTGCTGGGGG - Intergenic
920949394 1:210558156-210558178 GGCTCTGTGTTAGGTGTTATGGG - Intronic
921025792 1:211280423-211280445 GGTACTGTGCAAAGTGTTAGGGG - Intronic
921573802 1:216809874-216809896 AGCTCTGTGCAAGGTGGTAGAGG - Intronic
922564690 1:226594009-226594031 GGCACTGTGCAAGGGGCTGGAGG + Intronic
923522764 1:234748707-234748729 GGCACTGGATAAGGTGCTTCAGG + Intergenic
923791930 1:237119056-237119078 GGCACATTCTAAGGTACTAGGGG - Intronic
1064093008 10:12401479-12401501 GGGCCTGTGTTAGGTGCTGGGGG + Intronic
1064912479 10:20417379-20417401 GGCACTGTGCTAGGAGCTGGAGG + Intergenic
1065045303 10:21742741-21742763 GCCACTGTGGAAAGTGCTGGTGG + Exonic
1065249552 10:23796760-23796782 GTTCCTGTGTAAGGTCCTAGTGG - Intronic
1067165413 10:43863139-43863161 GGCACTGCTCGAGGTGCTAGGGG + Intergenic
1068235407 10:54227049-54227071 GGTACTGTGTAAGCTGTTGGTGG + Intronic
1070645076 10:78196201-78196223 GGCACTGTGCCAGGTTCTGGGGG - Intergenic
1072223361 10:93346482-93346504 GGGACTGTGTTAGGGGCTGGGGG - Intronic
1072290767 10:93962249-93962271 GGTACAGTGTAAGGTGCTGCAGG - Intergenic
1072562571 10:96589695-96589717 GGCACTCTGGTAGGTACTAGGGG + Intergenic
1072954756 10:99878560-99878582 GGCACTGAGGAATGTGCTATGGG + Intronic
1074734460 10:116414304-116414326 TGCACTGTGCTAGGTGCTGGAGG + Intergenic
1074949229 10:118312838-118312860 GGCACTGTTCTAGGTGCTGGAGG + Intronic
1075087605 10:119423945-119423967 GGCACTGTGCTGGGTGCTGGGGG + Intronic
1075162475 10:120036597-120036619 TGCACTGGGTAAGATGCTATAGG + Intergenic
1076134441 10:128035943-128035965 GGCCCTGTGTAAGGTGATTTGGG - Intronic
1076219256 10:128719707-128719729 GGCACAGTGCAGGGAGCTAGGGG + Intergenic
1076581922 10:131517575-131517597 GGCACTGTGTCAGCTGCTGGGGG - Intergenic
1076652383 10:131998829-131998851 GCCACTGTGTGAGGTGGCAGTGG + Intergenic
1078349712 11:10582398-10582420 GGCACATTGTAATGTGCTGGGGG + Intronic
1078602077 11:12741989-12742011 GGCTCTGTATCAGGTGCTTGTGG - Intronic
1078615401 11:12860657-12860679 AGCAGTGTGCTAGGTGCTAGGGG + Intronic
1078845966 11:15118589-15118611 GGTACTGAGTAATGTGCTGGTGG + Intronic
1079158171 11:17968138-17968160 GGCTCTGTGTTAGGTGCTGTGGG - Intronic
1081598060 11:44473001-44473023 GGCACTGTGCCAGGCCCTAGGGG - Intergenic
1081721778 11:45294644-45294666 GGCACTGTGTAAACTGCTCCAGG + Intergenic
1082783454 11:57303626-57303648 GGCTCTGGGTCAGGTGCTGGGGG - Intronic
1083632085 11:64101007-64101029 GGCACTGAGCCAGGTGCTGGGGG + Intronic
1084403797 11:68959804-68959826 TGCTCTGTGCAGGGTGCTAGGGG + Intergenic
1085000768 11:73031874-73031896 GGCACTGTATTAGATGCTGGGGG + Intronic
1086010157 11:82093083-82093105 GGCACTGTCCAAGGTACTATGGG + Intergenic
1086124027 11:83331391-83331413 GGCACTGTGTTAAGCACTAGGGG - Intergenic
1087344922 11:96959738-96959760 GGCACTGTGAAAGGCGCTAAAGG + Intergenic
1087792918 11:102426052-102426074 GGCACTGTGCCAGGTACTGGGGG - Intronic
1087843396 11:102943175-102943197 GGCACTGTGGGAAGTGCTGGGGG + Exonic
1088215817 11:107507900-107507922 GGCACTGTGAAAGATGATATAGG - Intronic
1088224931 11:107609568-107609590 GGCTCTTTGTAAAGTGCTACGGG - Intronic
1089363885 11:117909392-117909414 GGCACTGTATCAGCTGCTAACGG - Intronic
1089396523 11:118139529-118139551 GGCACTGTGCCAGATGCTATAGG - Intronic
1089751288 11:120653146-120653168 GGCACTGTCCAAGGTGCTGAAGG + Intronic
1089787226 11:120916492-120916514 GGCACTGTGTTAGGTGCATAAGG - Intronic
1089978603 11:122754025-122754047 GGCCATGTTTCAGGTGCTAGTGG - Intronic
1090417983 11:126554036-126554058 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1091202714 11:133794408-133794430 GGCACTGTCCAGGGTGCTGGGGG - Intergenic
1091400928 12:180134-180156 AGCACTGTTTCAGGTGCTGGGGG + Intergenic
1092113432 12:5981099-5981121 GGCACTGTGCTAGGTGCTATGGG - Intronic
1092963579 12:13619635-13619657 GGCACTGGGCTATGTGCTAGAGG + Intronic
1093051168 12:14506472-14506494 TTCACTGTGTAAGGTTCTTGAGG - Intronic
1093755445 12:22846771-22846793 TGCTCTGTGTAAGGTCCTAGAGG + Intergenic
1093996549 12:25649094-25649116 GGCACTGTGCTCAGTGCTAGGGG + Intergenic
1096187216 12:49589006-49589028 GGCACTGGGTGAGGAGCTGGGGG + Intronic
1096370275 12:51063733-51063755 GGCAGTGTGACAGGCGCTAGAGG - Exonic
1096627749 12:52905628-52905650 GGCACTGCACCAGGTGCTAGGGG - Intronic
1098581841 12:72109131-72109153 GGCAATTTGTCAGGTGCTAGTGG + Intronic
1099632364 12:85166923-85166945 GGCACTGTGCTAAGGGCTAGGGG - Intronic
1099668490 12:85660350-85660372 TGCACTGTGTAAGCTGTCAGTGG - Intergenic
1103217877 12:119217211-119217233 GGCACTTTGCAAGTTGCTGGGGG + Intronic
1105507355 13:21021832-21021854 GGCACTGTGAAAGGTGCCCTGGG - Intronic
1105535168 13:21259315-21259337 GCCACTGTGTGAGCTGCTACCGG + Intergenic
1105913473 13:24892131-24892153 GGCACTGCATTAGGTGCTTGGGG - Intronic
1106211123 13:27647176-27647198 GATACTGTGCAAGGTGCTATGGG - Intronic
1106797219 13:33219087-33219109 GGTACTATGTAAGATGCTAAGGG + Intronic
1108299255 13:49057965-49057987 GGCACAGTCTGAGGTACTAGGGG - Intronic
1109314943 13:60739492-60739514 GGAACTGTGTAAAGTGCTGAGGG + Intergenic
1109810763 13:67509644-67509666 TGCACAGTGTAAGCTGCTTGTGG - Intergenic
1110266998 13:73549969-73549991 AGAACTCTGTAAGGTGCTATGGG + Intergenic
1113801299 13:113087817-113087839 GGCAATGTGTAAGAGGCCAGGGG - Intronic
1117747018 14:58879969-58879991 GGCCCTGTGTTAGGTGCTGTGGG - Intergenic
1118196236 14:63629148-63629170 GGCACTCTTCTAGGTGCTAGAGG + Intronic
1118661717 14:68021068-68021090 GACACAGTGTAAGGTCCCAGGGG - Intronic
1118689555 14:68324964-68324986 GGCACTGTGTTAGTTGCTGTGGG - Intronic
1119603112 14:75990819-75990841 GGAACAGTGTAAAGTGCCAGAGG - Intronic
1120908474 14:89642890-89642912 GGCACTGTGCTAGGTACTGGGGG - Intergenic
1121267358 14:92612951-92612973 GGCTTTGTGTAAAGTGCCAGGGG + Intronic
1123438079 15:20270216-20270238 GGCACTGTGCTGGGTGCCAGAGG - Intergenic
1124401503 15:29352380-29352402 GACTCTGTGTAATGTGCTTGTGG - Intronic
1124816128 15:32994630-32994652 GGCACTGTGCTAGGTGCTCGAGG - Intronic
1125289734 15:38132534-38132556 GGCAGTGTGCTAGGTGCTGGGGG - Intergenic
1125356419 15:38821264-38821286 GGCACTGTGCTGGGTGCTGGAGG + Intergenic
1125459151 15:39892091-39892113 AGCACTGTGCCAGGTGCTATAGG + Intronic
1127663733 15:61124061-61124083 GGCATTGTGCTAGGTGCTGGCGG - Intronic
1128325553 15:66721736-66721758 GGCACTGTGCATAGGGCTAGGGG + Intronic
1128983244 15:72201169-72201191 GGGACTGTTTCAGGAGCTAGGGG - Intronic
1129155302 15:73713871-73713893 AGCACTGTGTTAGGTGCTGGGGG + Exonic
1129505934 15:76081444-76081466 GGCACAGTGGAAGGTGATATAGG - Intronic
1131641730 15:94300581-94300603 GGCAGTGTGAAAGTTGCTATTGG + Intronic
1131760616 15:95618682-95618704 GGCACTGTGCTAGGCGCTAGGGG + Intergenic
1132701490 16:1224018-1224040 AGCACTGTCCAAGGTGCTCGGGG + Intronic
1135149943 16:19996644-19996666 GGCATTGTGTTAGGTGCTGGGGG - Intergenic
1135525965 16:23213753-23213775 GGTGCTGTGTGAGGTGCTGGGGG + Intronic
1136558901 16:31026759-31026781 GGCACTGTTGTAGGTGCTGGGGG + Intergenic
1136846499 16:33580636-33580658 GGCACTGTGCTGGGTGCCAGAGG + Intergenic
1137976611 16:53037521-53037543 GGGAGTGTGGAAGGTCCTAGTGG + Intergenic
1138056977 16:53845358-53845380 GGTACTGTGTAAGGTTCCAGGGG + Intronic
1138228698 16:55323019-55323041 AGATCAGTGTAAGGTGCTAGTGG + Intergenic
1138261498 16:55626683-55626705 GGCACTGTGCTAGCAGCTAGGGG + Intergenic
1140094756 16:71865361-71865383 AGCTCAGTGTAAGGTGCTTGGGG - Intronic
1141097590 16:81173948-81173970 GGTACTGAGTGTGGTGCTAGAGG - Intergenic
1141634937 16:85309622-85309644 GGCACTGTGGAAGCTGCTCCCGG - Intergenic
1141795826 16:86273583-86273605 GGCACTGTGGAAGGACCTATGGG - Intergenic
1142270417 16:89086167-89086189 GGCCCTGAGTAAGGGGCTATGGG - Intergenic
1203108207 16_KI270728v1_random:1429290-1429312 GGCACTGTGCTGGGTGCCAGAGG + Intergenic
1142620164 17:1160573-1160595 GGCACTGTTCCAGGTGCCAGGGG + Intronic
1142963403 17:3565371-3565393 GGCTCTGTGTAGGCTGCTTGTGG - Intergenic
1143388702 17:6547511-6547533 GGCACAGTGGCAGGTGCTACGGG - Intronic
1143819803 17:9551184-9551206 GGAACAGTTTAAGGTTCTAGAGG + Intronic
1144547778 17:16214378-16214400 GGCACTGTGCAAGGAGCAACAGG - Intronic
1145882965 17:28365158-28365180 GGCAAAGGGTAAGGTGCCAGAGG + Exonic
1147250066 17:39147823-39147845 GGCACTGTGCTGGGTGCTGGGGG + Intronic
1147378075 17:40034866-40034888 AGCACTGTGCTAGGTGCTGGGGG - Intronic
1147773355 17:42883140-42883162 GGTACTGTGCTAGGTGCTGGCGG + Intergenic
1147923596 17:43933294-43933316 GGCACTGTGCTAGATGCTGGAGG + Intergenic
1149542429 17:57477699-57477721 GGCAGTGTGCTAGGTGCTGGGGG + Intronic
1149689227 17:58560149-58560171 AGCACTGTGCTAGGGGCTAGAGG - Intronic
1150067721 17:62125461-62125483 GACACTGTGTTAGGTGCCGGTGG - Intergenic
1151328215 17:73391685-73391707 GACACTGTGTTAGGAGCCAGGGG + Intronic
1151887366 17:76931020-76931042 GGCTCTGTTTCAGGTGCTGGTGG + Intronic
1152063625 17:78097706-78097728 GGCACTGAGCAAGGTGGTGGCGG - Intronic
1153167340 18:2277728-2277750 GGTACTGTATAGGGTTCTAGTGG - Intergenic
1155554980 18:27008754-27008776 AGCACTGTGGCAGGTGCTAAAGG - Intronic
1156556899 18:38078099-38078121 GCCAATGTGTCAGCTGCTAGGGG - Intergenic
1157421152 18:47548713-47548735 AGCACTGTGCAAGGTGCTTTGGG - Intergenic
1157713583 18:49866719-49866741 GGCACTGTGCTAGGTGCTGCAGG + Intronic
1158572141 18:58605465-58605487 GGCACTGTGCCAGGCTCTAGGGG + Intronic
1158590657 18:58776058-58776080 GGCACTGTGCTAGCTGGTAGGGG + Intergenic
1158924760 18:62244272-62244294 GGCACTGGGTCAAGTGCTAAGGG + Intronic
1159130079 18:64271436-64271458 GGCACTGTGCCAGGTGCTGGCGG - Intergenic
1159915029 18:74181146-74181168 GCCACATTGTAAGGTACTAGAGG + Intergenic
1163040316 19:14597260-14597282 GGCACTGTGCTAGGTACCAGGGG + Intronic
1163234880 19:16024412-16024434 GGCACTGTGGAAGGTGGCAGTGG - Intergenic
1164720794 19:30430369-30430391 GGCTCTGTGTTGGGTGCTGGGGG + Intronic
1167023838 19:46899750-46899772 ATCACTGTGTAAAGTGCTATGGG - Intergenic
1167486900 19:49767868-49767890 GGCAGTGTGGAGGGGGCTAGAGG + Intronic
1168585888 19:57591486-57591508 CCCACTGTGCAAGGTGGTAGAGG - Exonic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
925995991 2:9293695-9293717 GGCACCGTGCTAGGTGTTAGAGG + Intronic
926788406 2:16543904-16543926 GGCACTGAGTAAGATGATGGAGG - Intergenic
927460637 2:23295514-23295536 GGCCAGGTGTATGGTGCTAGTGG - Intergenic
927635769 2:24815411-24815433 GGCACTGTGGAAGCTACTGGAGG + Intronic
928420739 2:31136567-31136589 GGCAGTGTGTTAGGTGCTATGGG - Intronic
928736797 2:34300758-34300780 GGCACTGTTTAATATGTTAGTGG + Intergenic
929914827 2:46126268-46126290 GGCACTGTGCAGCGTGCTGGGGG + Intronic
930166385 2:48207490-48207512 TGCATTGTGAGAGGTGCTAGCGG + Intergenic
931896863 2:66741921-66741943 GGCACTGTGGTAGGAGCTACAGG + Intergenic
932503137 2:72202549-72202571 GGCCCTTGGTAAGGTCCTAGAGG - Intronic
932613651 2:73218336-73218358 GGCACTGTGCTAGGTGCTGTGGG + Intronic
932704044 2:74009785-74009807 GGGAATGTGTAAGATGCCAGGGG + Intronic
933781688 2:85807038-85807060 GGCAATGTGGAAGGTGCAAAAGG + Intergenic
934949911 2:98569277-98569299 TGCTGTGTGTAAAGTGCTAGAGG + Intronic
936445256 2:112589766-112589788 GGCACTGTGTCAAGTGCTTACGG - Intergenic
937263124 2:120598969-120598991 GGCAGTGTGTAATGGGGTAGAGG - Intergenic
938115719 2:128601960-128601982 AGCACTGTGTGATGGGCTAGGGG + Intergenic
938648158 2:133352323-133352345 GGCACAGTGTCAGATGCTAGAGG - Intronic
938927894 2:136061102-136061124 GGCATTGTGTTAGGTGCTTCAGG - Intergenic
938970521 2:136426882-136426904 GACACTGTGTTAGGTGCCAGGGG + Intergenic
941162231 2:162048884-162048906 TGAACTGTGTTAGGTGCTAAAGG - Intronic
942022607 2:171881742-171881764 GGTACTGTGCAAGGTGCTAGAGG - Intronic
942182112 2:173389984-173390006 GGCACTGTAAAAGGAGCTCGGGG - Intergenic
944819043 2:203410506-203410528 GGCACTGTGCCAGGTGATTGAGG + Intronic
947850267 2:233281973-233281995 GGCACTGTGCCAGGTGCTGGGGG - Intronic
948908492 2:240991344-240991366 GGCCCTGGGGAAGGTGCTGGAGG + Intronic
1168980821 20:2002365-2002387 GGAACTCTAAAAGGTGCTAGCGG + Intergenic
1169199963 20:3704110-3704132 GGTATTGGGTAAGGTGCTTGGGG + Intronic
1169712498 20:8580659-8580681 GGCACTATGATAGGTGCTGGGGG + Intronic
1170223918 20:13970050-13970072 GAAACTGTGCAGGGTGCTAGAGG - Intronic
1170260890 20:14406914-14406936 GGCTCTTTGTAAGGTGTTAGGGG - Intronic
1171250921 20:23646604-23646626 AGCACTGTGTCAGGTGCCTGAGG + Intergenic
1171294541 20:24005936-24005958 GTCACTGTGTAAGGAGATTGTGG + Intergenic
1171953603 20:31442393-31442415 AGCACTGTGATGGGTGCTAGAGG + Intronic
1172027507 20:31959086-31959108 GGCACTGTGTGTGTTGATAGGGG - Intergenic
1172163133 20:32882391-32882413 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1173190348 20:40871114-40871136 GGCCCAGTGCAAGGTACTAGGGG + Intergenic
1173340783 20:42150977-42150999 GGCATTGTGCCAGGTGCTATGGG - Intronic
1173538518 20:43833721-43833743 GGCACTGTTCCAGGTCCTAGGGG + Intergenic
1173556482 20:43969719-43969741 GGCACTGTGCAAGGTGCCCAAGG + Intronic
1174187962 20:48720396-48720418 GGCACTGCTTGAGGTGCTAGAGG - Intronic
1174465470 20:50713847-50713869 GGCACTGTCTGAGCTGCAAGTGG - Intergenic
1174517477 20:51103661-51103683 GGCAGCGTGTAAGGTGCAGGTGG - Intergenic
1175538508 20:59732824-59732846 GGCACTGTGCTAGGTGCCGGAGG + Intronic
1175992802 20:62797779-62797801 GGCACTGTGTGACGGGCGAGCGG + Intronic
1177198113 21:17924120-17924142 AGCACTTTGTATGGTGCTACCGG - Intronic
1180022483 21:45137283-45137305 TCCCCTGTGTAAGGTGCTGGAGG + Intronic
1181496637 22:23290905-23290927 TGCACTGTGTAAGTTTCTCGAGG + Intronic
1181949507 22:26543924-26543946 CCCACTGTGGAAGGAGCTAGAGG + Intronic
1182070423 22:27459558-27459580 GGTCCTGTGTCAGGTGCTGGGGG - Intergenic
1182659928 22:31917975-31917997 GCCACTGTGAAAGGTGTAAGGGG + Intergenic
1183794517 22:40104543-40104565 GGCACTGTGCAAGATGGTGGAGG + Intronic
1184089966 22:42287628-42287650 GGCACAGTGCAAGGTGGCAGGGG - Intronic
949987955 3:9554151-9554173 GGCACTGTGATAGGTTCCAGGGG - Intergenic
950724384 3:14907071-14907093 TGCCCTGTGTAAGGTTCAAGGGG + Intronic
951491928 3:23280443-23280465 GGGATTGTGAATGGTGCTAGAGG + Intronic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
952212367 3:31241257-31241279 GGCACGGTGTCAGGTGCTAGGGG - Intergenic
952862073 3:37821354-37821376 GGCACTGTGCAAGGTGCTGGAGG + Exonic
956095993 3:65716767-65716789 GGCTTTGTGTTAGGTGCTAGGGG + Intronic
957619439 3:82575768-82575790 GGCACTGTGTAAGGCATTAGAGG - Intergenic
957714656 3:83910227-83910249 GGCACTGTGGTAGGAGCTACAGG - Intergenic
957714898 3:83914603-83914625 GGCACTGTGGTAGGAGCTACAGG - Intergenic
959020620 3:101184185-101184207 GGAACTGTGTAAGGTGCTGCTGG + Intergenic
959189266 3:103089437-103089459 GGCAATGTGGATGGAGCTAGAGG - Intergenic
962170503 3:133096605-133096627 GGCACAGTGCATGGTGGTAGGGG - Intronic
962235502 3:133703803-133703825 GGCACTGAGTACAGTGCTAGTGG + Intergenic
962284848 3:134076979-134077001 GGCCCTGTGCGAGGTGGTAGAGG + Intronic
962385349 3:134928332-134928354 GGGACTGTGTATTGTGCTATTGG - Intronic
962468145 3:135679633-135679655 TGCACTGTGCAAGGTGCTGCAGG - Intergenic
962961595 3:140316093-140316115 GGCTCTGTGCTAGGTGCCAGAGG + Intronic
963267564 3:143254225-143254247 TGCACTGAGCAATGTGCTAGAGG - Intergenic
966937118 3:184717947-184717969 GGCGCTGAGTAAGGTGCTATGGG + Intergenic
966966603 3:185001063-185001085 GGCACTGTGCCAGGTGCCTGGGG + Intronic
967220998 3:187248036-187248058 GGCACTGTGCTAGGTCCTAGGGG - Intronic
967387215 3:188923509-188923531 GGCATTATATAAGGTGCTACTGG + Intergenic
970003963 4:11393096-11393118 GGCACTGTGTTAAGTGCCAGAGG + Intergenic
970724748 4:19030663-19030685 GCCACTGTCTCAGGTGCCAGGGG + Intergenic
971272277 4:25161091-25161113 GGCACTGTTTTAGGTGCCCGGGG - Intronic
972299636 4:37772626-37772648 GGCACTGTGCTAGGTGCTAATGG + Intergenic
972645993 4:40967850-40967872 GGCACTGTGCTTAGTGCTAGGGG - Intronic
973801586 4:54483690-54483712 GTCACTGTGCTAGGTGCTTGGGG + Intergenic
974064758 4:57067290-57067312 TGCACTGTTTAAGGTTATAGAGG - Intronic
975828818 4:78347856-78347878 GGCACTGTGGAAGGTAATATAGG - Intronic
975868774 4:78754332-78754354 GGCACTGTGTTATGTACTTGAGG - Intergenic
976298184 4:83493001-83493023 GGCACTGTGCTAGTTGCTGGAGG + Intronic
976923950 4:90473919-90473941 GGCACTCTGCATAGTGCTAGGGG + Intronic
978006664 4:103625798-103625820 GTCACAGTGTAAGGTACTGGGGG - Intronic
978066338 4:104407371-104407393 GGCACTGGGTTAGGTGCTGATGG + Intergenic
979390305 4:120119438-120119460 GCCACAGTGTAAGGATCTAGAGG - Intergenic
979455077 4:120918066-120918088 GGCACTGTTTTAGTTACTAGTGG - Intronic
979783028 4:124680249-124680271 GGCACTATGCTAGGTTCTAGGGG - Intronic
980742704 4:136973195-136973217 GGCACAGTGCAAGCTGCCAGTGG + Intergenic
982037409 4:151359775-151359797 GGCACTGTGCCAGTTGCTAAGGG + Intergenic
982194415 4:152895886-152895908 GTCACTGAGTTAGGTGATAGAGG + Intronic
982762961 4:159309413-159309435 GGCACTGTGCTAGGCTCTAGGGG - Intronic
982819369 4:159927183-159927205 GGTACTTTGGGAGGTGCTAGTGG + Intergenic
982904248 4:161048375-161048397 TGCACAGTGTAAGCTGTTAGTGG + Intergenic
983268910 4:165538264-165538286 GGCACTATGCAAGTTGCTAGGGG + Intergenic
983322669 4:166213537-166213559 TGCACAGTGTAAGGTGTTGGTGG + Intergenic
983968995 4:173848331-173848353 GTCACATTGTAAGGTACTAGAGG + Intergenic
985259709 4:188103785-188103807 GGGACTATGCAAGGTGCTAGGGG - Intronic
989236040 5:39149711-39149733 GAAACTGTGTCAGGTGCTGGTGG - Intronic
990464171 5:56056585-56056607 GGTACTGTGTATGATGCTGGGGG + Intergenic
990506432 5:56449812-56449834 GGCAGTGTGCTACGTGCTAGAGG - Intergenic
991348611 5:65696567-65696589 GGCACAGTATAAGGTGCTATAGG + Intronic
994676867 5:102834379-102834401 GGCACTGTGCTAGGTACTGGTGG + Intronic
995892528 5:116971094-116971116 AGTACTGTGCAAGGTGCTAATGG + Intergenic
996410190 5:123150690-123150712 GGCACTGTGTAAATAGGTAGAGG + Intronic
998378220 5:141705497-141705519 GGCACTGTTCAAGATGCTGGGGG - Intergenic
1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG + Intergenic
1000494432 5:161962748-161962770 GGAATTGTGATAGGTGCTAGAGG + Intergenic
1001333400 5:170778189-170778211 GGCACTGTGCTAAGTGCTGGTGG - Intronic
1001419035 5:171573025-171573047 GACACTGTGCTTGGTGCTAGAGG - Intergenic
1002596648 5:180328167-180328189 GGCACGCTGAAAGGTGCTCGTGG - Intronic
1004403972 6:15314397-15314419 GGCACTGTTCCAGGTGCTTGGGG - Intronic
1004484899 6:16057270-16057292 GCCACTGTGGAAGGTGCTATAGG - Intergenic
1005304856 6:24503876-24503898 GGCACTGGGCCAGGTTCTAGAGG + Intronic
1005765646 6:29009045-29009067 GGCACTGTGCAAGGAGCTACAGG + Intergenic
1006512275 6:34528147-34528169 GGCACTGTGTTAGGTGGTGCAGG - Intronic
1006803050 6:36771612-36771634 GGCACTGTGTTGGGTGCTGTGGG - Intronic
1007718049 6:43868778-43868800 GCCTCTGTATCAGGTGCTAGAGG - Intergenic
1012176515 6:96093209-96093231 AGAACTGTGCAAGGTACTAGGGG - Intronic
1012430289 6:99156980-99157002 AGCACTGTGTCAGGAGCTACGGG + Intergenic
1013552111 6:111217944-111217966 GGCACTGTGCTATGTGCTAGAGG - Intronic
1013639384 6:112058442-112058464 GGCACTGTGCTAGGTGCTGGTGG + Intronic
1015257184 6:131191768-131191790 GGCACTGTCCAAAGTGCTGGTGG - Intronic
1015631350 6:135235152-135235174 GGCACTGTATTAAGTGCTATGGG - Intergenic
1015952561 6:138568075-138568097 AGCACTGTGGAAGGTCCTTGAGG - Intronic
1017597966 6:156049840-156049862 GGCACAGTGTTAGGCACTAGGGG + Intergenic
1018360049 6:163058312-163058334 GGAACTGTGTAAGGAGCTGCTGG - Intronic
1018964556 6:168474330-168474352 GGCACTGTGAAAGGTGCCCCAGG - Intronic
1021608129 7:22430032-22430054 GGCACTGTTGAAGATGCTAGTGG - Intronic
1021636438 7:22698787-22698809 GGCACTGTTCTAGATGCTAGGGG + Intergenic
1023014836 7:35956466-35956488 GGTACTGTGCTTGGTGCTAGGGG + Intergenic
1024066168 7:45738554-45738576 GGTACTGTGCTTGGTGCTAGGGG - Intergenic
1026682365 7:72476765-72476787 GGCACTGTACAAGGTGCTGGAGG + Intergenic
1029521383 7:101064867-101064889 GGCACGGTGTTAGGTGCTGTGGG - Intergenic
1031557352 7:123194052-123194074 GGCACTGGGTTTGGTGCTGGAGG + Intronic
1032022490 7:128416729-128416751 GGCACTGTGCTAGGTGTTAGAGG + Intergenic
1032695164 7:134329545-134329567 GGCACTGTTCTAGGTGCTGGAGG - Intergenic
1032874998 7:136028875-136028897 GGCACTGTAATAGGTGCTAGAGG - Intergenic
1033257508 7:139814937-139814959 GGCACAGAGACAGGTGCTAGGGG - Intronic
1034202388 7:149290523-149290545 GGCACTGTGTAAGGTGCTAGAGG - Intronic
1035281317 7:157780252-157780274 GGCCGTGTGTAAGGAGCAAGGGG - Intronic
1038425260 8:27460513-27460535 GGCGCTGTGCTAGGTGCTGGGGG + Exonic
1038837887 8:31148881-31148903 GGCATTGTGCTAGGTGCTACAGG - Intronic
1039193490 8:35003533-35003555 GGCACTGAGCAAAGTACTAGGGG - Intergenic
1041530751 8:58863765-58863787 CGCACTGTGAGAGGTCCTAGGGG + Intronic
1042041744 8:64599005-64599027 GGGCCTGTGTCAGCTGCTAGGGG + Intronic
1042622023 8:70717187-70717209 TGCACTGTGCAAGCTGTTAGTGG + Intronic
1043583859 8:81744811-81744833 GGCACTGTGTTAGGCACTGGAGG - Intronic
1044220392 8:89663218-89663240 TGCACTGTGTAAGCTGTCAGTGG + Intergenic
1044639399 8:94362688-94362710 TGCACTGAGCAAGGTTCTAGTGG - Intergenic
1044680331 8:94771403-94771425 GGCATTGTGCTAGGTGCTAAAGG + Intronic
1044863306 8:96544677-96544699 GGCACTGTGCAAAGTGCTGTGGG - Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1045406002 8:101867379-101867401 GGCACTGTGCTAGGTCCTGGGGG - Intronic
1045918757 8:107505176-107505198 TTCACTGTTTCAGGTGCTAGGGG - Intergenic
1046056885 8:109088853-109088875 GACACTGTGTAGGGAGCTGGAGG - Intronic
1046773986 8:118144445-118144467 GGCACTGTGCTAGGTGCTTTGGG - Intergenic
1047232540 8:123009652-123009674 TGCACTGTGTAATCTGCTAATGG - Intergenic
1048384537 8:133899304-133899326 GGCACTGCGCTAGCTGCTAGAGG - Intergenic
1049004851 8:139848012-139848034 GGCCCTGCGTGAGGGGCTAGGGG - Intronic
1050556523 9:6794161-6794183 GACACTATGCCAGGTGCTAGAGG + Intronic
1053377828 9:37623134-37623156 GACACTGTGTTAGGTGCTGAGGG + Intronic
1055759033 9:79587112-79587134 GGCATTGTTTTAGGTGCTAGTGG - Intronic
1056100504 9:83296435-83296457 AGCACTGTGTTAGGTGCTGGGGG + Intronic
1056748058 9:89322075-89322097 TGCACTGTGAAAGGTACTGGAGG - Intronic
1058170549 9:101675522-101675544 GGCACTGTCCTAGGTGCTGGGGG + Intronic
1059379654 9:113913175-113913197 GGCACTGAGTGAGATTCTAGGGG - Intronic
1060653153 9:125348193-125348215 GGCACAGTGGAACGTGCTTGTGG - Intronic
1062702534 9:137914869-137914891 GGCACTGTTCTAGGTGCTAGAGG + Intronic
1186552203 X:10517971-10517993 TGCACTGTGTTAGGTGCCAAAGG - Intronic
1189333993 X:40158838-40158860 GGCGCTGTGTTAGGACCTAGGGG + Intronic
1189863003 X:45292438-45292460 GGCACTGTGCTAGGTGCTTTGGG + Intergenic
1190451430 X:50585162-50585184 GGCACTGTGCTAAGTGTTAGTGG + Intergenic
1190738376 X:53270698-53270720 GGCACTGTGTTAGGCACTAGGGG - Intronic
1192497333 X:71624659-71624681 GACACTGTGTAAGGTGAGAGGGG + Intergenic
1193295360 X:79826582-79826604 GGCACTGTGTCAGGGGCTCAAGG + Intergenic
1194747366 X:97642750-97642772 GGCACTGTGCTAGGCCCTAGAGG - Intergenic
1196285244 X:113871840-113871862 GGCACAGTGCAAGCTGTTAGTGG - Intergenic
1197259833 X:124306056-124306078 GGTACTATGCTAGGTGCTAGGGG + Intronic
1199154986 X:144536631-144536653 TGCACTGTGCAAGGTGTTGGTGG + Intergenic
1199806930 X:151309373-151309395 GGCACTGTGCTTGGTGCTACAGG + Intergenic
1200325574 X:155234908-155234930 GGCACTGTATAAGATGCTCAAGG - Intronic
1201964904 Y:19721481-19721503 GGCACTGTGTTAGTTGACAGTGG - Intronic