ID: 1034210095

View in Genome Browser
Species Human (GRCh38)
Location 7:149355936-149355958
Sequence CTGAGTAAGTGCAGGGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034210085_1034210095 16 Left 1034210085 7:149355897-149355919 CCTTCTCCCACAGCTCTGCCACC No data
Right 1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG No data
1034210084_1034210095 22 Left 1034210084 7:149355891-149355913 CCAGTTCCTTCTCCCACAGCTCT No data
Right 1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG No data
1034210088_1034210095 -2 Left 1034210088 7:149355915-149355937 CCACCTCTCCACTCTCAGTTCCT No data
Right 1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG No data
1034210090_1034210095 -10 Left 1034210090 7:149355923-149355945 CCACTCTCAGTTCCTGAGTAAGT No data
Right 1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG No data
1034210086_1034210095 10 Left 1034210086 7:149355903-149355925 CCCACAGCTCTGCCACCTCTCCA No data
Right 1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG No data
1034210089_1034210095 -5 Left 1034210089 7:149355918-149355940 CCTCTCCACTCTCAGTTCCTGAG No data
Right 1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG No data
1034210087_1034210095 9 Left 1034210087 7:149355904-149355926 CCACAGCTCTGCCACCTCTCCAC No data
Right 1034210095 7:149355936-149355958 CTGAGTAAGTGCAGGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034210095 Original CRISPR CTGAGTAAGTGCAGGGATCT GGG Intergenic
No off target data available for this crispr