ID: 1034211467

View in Genome Browser
Species Human (GRCh38)
Location 7:149367287-149367309
Sequence TCATCCCTAGCATCTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034211458_1034211467 1 Left 1034211458 7:149367263-149367285 CCTTTCCCTGTCCCCATCTAGCA No data
Right 1034211467 7:149367287-149367309 TCATCCCTAGCATCTAGGGTGGG No data
1034211461_1034211467 -10 Left 1034211461 7:149367274-149367296 CCCCATCTAGCATTCATCCCTAG No data
Right 1034211467 7:149367287-149367309 TCATCCCTAGCATCTAGGGTGGG No data
1034211459_1034211467 -4 Left 1034211459 7:149367268-149367290 CCCTGTCCCCATCTAGCATTCAT No data
Right 1034211467 7:149367287-149367309 TCATCCCTAGCATCTAGGGTGGG No data
1034211460_1034211467 -5 Left 1034211460 7:149367269-149367291 CCTGTCCCCATCTAGCATTCATC No data
Right 1034211467 7:149367287-149367309 TCATCCCTAGCATCTAGGGTGGG No data
1034211457_1034211467 4 Left 1034211457 7:149367260-149367282 CCTCCTTTCCCTGTCCCCATCTA No data
Right 1034211467 7:149367287-149367309 TCATCCCTAGCATCTAGGGTGGG No data
1034211456_1034211467 5 Left 1034211456 7:149367259-149367281 CCCTCCTTTCCCTGTCCCCATCT No data
Right 1034211467 7:149367287-149367309 TCATCCCTAGCATCTAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034211467 Original CRISPR TCATCCCTAGCATCTAGGGT GGG Intergenic
No off target data available for this crispr