ID: 1034214545

View in Genome Browser
Species Human (GRCh38)
Location 7:149395016-149395038
Sequence CACTTCCCAACCCCACTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034214541_1034214545 28 Left 1034214541 7:149394965-149394987 CCACCGAGTGCTCTCTGTGGTCT No data
Right 1034214545 7:149395016-149395038 CACTTCCCAACCCCACTGTCTGG No data
1034214542_1034214545 25 Left 1034214542 7:149394968-149394990 CCGAGTGCTCTCTGTGGTCTAGC No data
Right 1034214545 7:149395016-149395038 CACTTCCCAACCCCACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034214545 Original CRISPR CACTTCCCAACCCCACTGTC TGG Intergenic
No off target data available for this crispr