ID: 1034214725

View in Genome Browser
Species Human (GRCh38)
Location 7:149396542-149396564
Sequence GCCATGGGCCATGAGTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034214719_1034214725 30 Left 1034214719 7:149396489-149396511 CCATGGGAGGCATTGAGGGCATG No data
Right 1034214725 7:149396542-149396564 GCCATGGGCCATGAGTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034214725 Original CRISPR GCCATGGGCCATGAGTTCCA TGG Intergenic
No off target data available for this crispr