ID: 1034215223

View in Genome Browser
Species Human (GRCh38)
Location 7:149400480-149400502
Sequence GTACCTCGGTGGGGAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034215223_1034215231 13 Left 1034215223 7:149400480-149400502 CCTCTCCTTCCCCACCGAGGTAC No data
Right 1034215231 7:149400516-149400538 GCAGTCAATCTCCTCCTTACTGG No data
1034215223_1034215234 28 Left 1034215223 7:149400480-149400502 CCTCTCCTTCCCCACCGAGGTAC No data
Right 1034215234 7:149400531-149400553 CTTACTGGAGTGCTAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034215223 Original CRISPR GTACCTCGGTGGGGAAGGAG AGG (reversed) Intergenic
No off target data available for this crispr