ID: 1034217873

View in Genome Browser
Species Human (GRCh38)
Location 7:149421985-149422007
Sequence GAGAAAAGTGGGTAGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034217866_1034217873 19 Left 1034217866 7:149421943-149421965 CCAGGAGCTGGGCCTCAGCCTTG No data
Right 1034217873 7:149421985-149422007 GAGAAAAGTGGGTAGAATGCAGG No data
1034217868_1034217873 7 Left 1034217868 7:149421955-149421977 CCTCAGCCTTGGTTTCCTCATCT No data
Right 1034217873 7:149421985-149422007 GAGAAAAGTGGGTAGAATGCAGG No data
1034217870_1034217873 -8 Left 1034217870 7:149421970-149421992 CCTCATCTGCACAACGAGAAAAG No data
Right 1034217873 7:149421985-149422007 GAGAAAAGTGGGTAGAATGCAGG No data
1034217869_1034217873 1 Left 1034217869 7:149421961-149421983 CCTTGGTTTCCTCATCTGCACAA No data
Right 1034217873 7:149421985-149422007 GAGAAAAGTGGGTAGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034217873 Original CRISPR GAGAAAAGTGGGTAGAATGC AGG Intergenic
No off target data available for this crispr