ID: 1034218357

View in Genome Browser
Species Human (GRCh38)
Location 7:149424786-149424808
Sequence GTTTCAAGACTCTGAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034218355_1034218357 7 Left 1034218355 7:149424756-149424778 CCCAAGCATGTTTGTATGCAATT 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1034218357 7:149424786-149424808 GTTTCAAGACTCTGAAGAGCTGG 0: 1
1: 1
2: 2
3: 20
4: 185
1034218356_1034218357 6 Left 1034218356 7:149424757-149424779 CCAAGCATGTTTGTATGCAATTA 0: 1
1: 0
2: 2
3: 11
4: 171
Right 1034218357 7:149424786-149424808 GTTTCAAGACTCTGAAGAGCTGG 0: 1
1: 1
2: 2
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034218357 Original CRISPR GTTTCAAGACTCTGAAGAGC TGG Intergenic
903015380 1:20358252-20358274 TTTTCATGTCTCTGAAGAGCAGG - Intergenic
906297262 1:44656490-44656512 CTCCCAAGACTCTGAAGAGGAGG + Intronic
907052034 1:51336064-51336086 GGTTCTAGACTCTGAAGAGGGGG - Intronic
909027818 1:70503533-70503555 GGTTAAAGCCTCTGGAGAGCTGG + Intergenic
909865869 1:80670286-80670308 GCTTCAAGACTCTGAAGAGGGGG - Intergenic
915706790 1:157851524-157851546 GTTTCTAGAGTGCGAAGAGCAGG - Intronic
917297751 1:173539556-173539578 GATTCATGAGTCTAAAGAGCTGG + Intronic
919821639 1:201476682-201476704 GTTTCAAGTCTCTGATGACTTGG + Intergenic
920619874 1:207534390-207534412 TGTTCAAGCCTCTTAAGAGCAGG - Intronic
920621656 1:207552945-207552967 TGTTCAAGCCTCTTAAGAGCAGG - Intronic
920623282 1:207570040-207570062 TGTTCAAGCCTCTTAAGAGCAGG - Intronic
921932332 1:220764962-220764984 GTTGGAACATTCTGAAGAGCAGG - Intronic
923058101 1:230443892-230443914 TTTCAAAGACTCTGAAGAGGTGG + Intergenic
1064111375 10:12542174-12542196 GTTTTAAAACACTGAAAAGCTGG - Intronic
1064540938 10:16404463-16404485 CTTTCAAGAACCTCAAGAGCAGG + Intergenic
1064920399 10:20510754-20510776 GTTTCAAGGCTCTTAAGGACAGG + Intergenic
1066389689 10:34968895-34968917 GTCTCCTGTCTCTGAAGAGCAGG + Intergenic
1069863284 10:71484438-71484460 TTTTCCAGACTCAGAGGAGCTGG + Intronic
1073430613 10:103484465-103484487 GTTTCCAGACCCTGAAAAGCGGG + Intergenic
1073884978 10:108027924-108027946 TTTCCAAAACTCTGAAGAGGAGG + Intergenic
1075500115 10:122965341-122965363 GTTTCAAAACTCTGACTGGCAGG - Intronic
1076547082 10:131252644-131252666 GTTTCAGGACTCGGTAGAGGAGG - Intronic
1079284898 11:19119521-19119543 GTGTCAAGACTTTAAAGAGGTGG - Intronic
1079471807 11:20785696-20785718 GTTCCAAGACATTGAAGAGCTGG - Intronic
1079871623 11:25805116-25805138 CTTTATAGACTCTGTAGAGCTGG + Intergenic
1080173914 11:29339245-29339267 GCTTCATGACTATGAAGACCTGG - Intergenic
1086252787 11:84837375-84837397 GTTTGAAGACACTGATGAGAAGG + Intronic
1087395406 11:97590056-97590078 GATGAAAGAATCTGAAGAGCGGG + Intergenic
1087885784 11:103480914-103480936 CTTTTAAATCTCTGAAGAGCAGG - Intergenic
1089647576 11:119890186-119890208 CTTTCAAAACTCTGGAGAGGAGG - Intergenic
1089715419 11:120354159-120354181 GTTTCACTATTCTCAAGAGCTGG + Intronic
1089829716 11:121316170-121316192 GAATCAGGAGTCTGAAGAGCAGG - Intergenic
1091039245 11:132261451-132261473 GTTATAATACTTTGAAGAGCAGG + Intronic
1092963270 12:13616579-13616601 GTGTCCAGAGACTGAAGAGCAGG - Exonic
1100908302 12:99328123-99328145 TTTGCAAGACACTGAAAAGCAGG + Intronic
1102068448 12:109998365-109998387 GTTGCAGGCATCTGAAGAGCTGG + Intergenic
1103233827 12:119355128-119355150 GTTTCAAGACTTTTAAAAGTAGG - Intronic
1103248237 12:119476818-119476840 GTGTAAAGACTCTGTAGAGGAGG - Intronic
1103842732 12:123878458-123878480 GTTTCAAGGCACTCAAAAGCAGG - Intronic
1108765674 13:53626297-53626319 TTCTAAAGACTCTGAGGAGCAGG + Intergenic
1110491563 13:76115629-76115651 CTTTCAAAGCTCTGAAGAGGAGG + Intergenic
1112052056 13:95652797-95652819 CTTTCTAAACTCTGCAGAGCAGG - Intergenic
1112114850 13:96340592-96340614 GTGCCAAGACACTGAAGAACTGG + Intronic
1113210740 13:107977026-107977048 GTTTCAAGAATGTGAAAAGATGG + Intergenic
1113581464 13:111433044-111433066 GTTTGAAGAGTTTGCAGAGCAGG - Intergenic
1114064039 14:19045122-19045144 GTATCTAGACACTTAAGAGCAGG + Intergenic
1114098220 14:19354874-19354896 GTATCTAGACACTTAAGAGCAGG - Intergenic
1114555512 14:23559946-23559968 GATTGAGGATTCTGAAGAGCTGG + Exonic
1115076081 14:29392234-29392256 GTTTTATTACTCAGAAGAGCTGG - Intergenic
1115956031 14:38780442-38780464 CTTTCAAGACATTGAAGAGGAGG + Intergenic
1118349989 14:64966917-64966939 GTTTCTAGACTGAGAGGAGCTGG - Intronic
1120779474 14:88473863-88473885 GTTTCAATGCACTGAAGACCAGG + Intronic
1121998056 14:98621100-98621122 GTTTCAAAACTTCGAAGAACTGG + Intergenic
1123492570 15:20794092-20794114 GTATCTAGACACTTAAGAGCAGG - Intergenic
1123549072 15:21363184-21363206 GTATCTAGACACTTAAGAGCAGG - Intergenic
1124386838 15:29216270-29216292 GTTTCAAGAGGCTGAAGATAGGG + Intronic
1125059879 15:35406703-35406725 GTTTCCTGACACTGAAGGGCTGG - Intronic
1125539252 15:40460210-40460232 GTTCTTAGACTCTGAAGAGCAGG + Intronic
1128735099 15:70049106-70049128 GTCCCAAGATTCAGAAGAGCTGG + Exonic
1129058681 15:72842332-72842354 CTTTCAAAACATTGAAGAGCAGG - Intergenic
1130368960 15:83266910-83266932 GCTTCAACACACTGAAGAGCCGG + Exonic
1130622830 15:85481730-85481752 ATTTAAAGACTGTGAAGAGGAGG - Intronic
1131386479 15:92012444-92012466 ATTTCATGACTCAGAATAGCAGG + Intronic
1202957406 15_KI270727v1_random:90406-90428 GTATCTAGACACTTAAGAGCAGG - Intergenic
1133326713 16:4946335-4946357 TTTTCAAGACCCTACAGAGCAGG - Intronic
1133883140 16:9801902-9801924 GTTTCTAGATTCTAGAGAGCTGG + Intronic
1134800461 16:17079530-17079552 CCTTCAAGACTCTAAAGAACAGG - Intergenic
1135011432 16:18883452-18883474 GCTTTAAGACTCTGAAGACCGGG + Intronic
1135318340 16:21471040-21471062 GCTTTAAGACTCTGAAGACTGGG + Intergenic
1135371233 16:21902835-21902857 GCTTTAAGACTCTGAAGACTGGG + Intergenic
1135440554 16:22467880-22467902 GCTTTAAGACTCTGAAGACTGGG - Intergenic
1136328541 16:29552471-29552493 GCTTTAAGACTCTGAAGACTGGG + Intergenic
1136443228 16:30292485-30292507 GCTTTAAGACTCTGAAGACTGGG + Intergenic
1136529035 16:30854497-30854519 GTTTCAACGCTTTGAAGAACAGG - Intronic
1138084374 16:54120312-54120334 GAGTCAATACTATGAAGAGCTGG - Exonic
1138727821 16:59159983-59160005 TTTTCAGGACACTTAAGAGCAGG + Intergenic
1139889956 16:70244905-70244927 GCTTTAAGACTCTGAAGACTGGG + Intergenic
1140111963 16:72012241-72012263 ATTTCAAGACTCTGACATGCTGG + Exonic
1143462174 17:7110796-7110818 CTTTCAAGACTCTGGACATCAGG + Intronic
1144057371 17:11554991-11555013 GGTGCAAGAATCTGAAGAGATGG - Intronic
1147133829 17:38424124-38424146 GAATCAAGAATCTGAAGACCTGG - Intergenic
1148925353 17:51079671-51079693 ATTTGAAGACTCTCAAGAACAGG - Exonic
1149131917 17:53313069-53313091 GTTTCATTACTCTACAGAGCTGG + Intergenic
1149491474 17:57087829-57087851 ATTTCAGGGCTTTGAAGAGCAGG + Intronic
1154450115 18:14468630-14468652 GTATCTAGACACTTAAGAGCAGG - Intergenic
1155017393 18:21858625-21858647 GTTACAAGACATTAAAGAGCAGG + Exonic
1155379853 18:25208160-25208182 ATATTAAGACTGTGAAGAGCTGG - Intronic
1155386318 18:25281995-25282017 TTTTCAAGAGTCTGAAAAACAGG - Intronic
1157600658 18:48891156-48891178 GTTTCAAGAGACAGCAGAGCTGG - Intergenic
1157998320 18:52586780-52586802 GTGACAATACTCTGCAGAGCTGG - Intronic
1159968829 18:74624012-74624034 GTTTCAAGATTGAGAAGACCTGG - Intronic
1164940309 19:32247314-32247336 GTTTCAAAGCTTTAAAGAGCAGG + Intergenic
1167499518 19:49837241-49837263 CTTTCAAGACTCTGAGGAGCTGG - Intronic
1168703358 19:58454402-58454424 GTTTCCAGAGTCAGAAAAGCAGG - Intronic
926500162 2:13643522-13643544 GTTTCACGGATCTGTAGAGCAGG - Intergenic
927630609 2:24770833-24770855 GTTTCTTGACTCAGAAGATCTGG + Intergenic
927656689 2:24954088-24954110 GTGGCTAGACTCTGCAGAGCAGG + Intronic
928221287 2:29405281-29405303 CTTTCGAAACTCTGATGAGCAGG + Intronic
931076258 2:58716635-58716657 GTTTCAAGAGTGTGAAGAGAAGG + Intergenic
931318903 2:61157408-61157430 GTATCAAGGCTCAGAAGAGGAGG + Intronic
932904856 2:75738686-75738708 GTCCCAAGCCTCTGAGGAGCTGG + Intergenic
933129372 2:78654521-78654543 GAATCAAGTTTCTGAAGAGCAGG + Intergenic
935379266 2:102434108-102434130 ATTTCAGAACTCTGAAGATCTGG + Intronic
938481299 2:131664106-131664128 GTATCTAGACACTTAAGAGCAGG + Intergenic
938616015 2:132999466-132999488 GTTTCCAGTGTCTCAAGAGCTGG + Intronic
938637174 2:133241063-133241085 GTTTCAAGCCTGTGACTAGCAGG + Intronic
939437062 2:142191045-142191067 GTTTCAAAAATCAGAGGAGCTGG - Intergenic
940236768 2:151519681-151519703 CTTTCATGACTTTGTAGAGCTGG + Exonic
942667551 2:178336396-178336418 GTTACAGGACTCGGAAGAGATGG + Exonic
942718500 2:178922408-178922430 GTGTCAAGACTGAGAAGAGCTGG - Intronic
943490615 2:188550981-188551003 GTTTAAAAACTCTGAAGAATTGG + Intronic
945617206 2:212086813-212086835 GTTTAAAGACTCTGATTAGATGG - Intronic
945622476 2:212157892-212157914 GTGTCAAGACTGTTAAGAGCAGG - Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
948415630 2:237801033-237801055 TTTTTAAGAATATGAAGAGCGGG + Intronic
1169190421 20:3655446-3655468 GTTTCAAGACACTGAAGTTGCGG - Intergenic
1169322872 20:4649126-4649148 GTTTCAACCCTCTGAGTAGCTGG + Intergenic
1169762539 20:9112160-9112182 GTGTTAAGAATCTGAAGAGAAGG + Intronic
1171798152 20:29582394-29582416 GTTTCATGATGCTGCAGAGCTGG + Intergenic
1171901080 20:30857503-30857525 TTTTCAAAACTTTGAAGAGGAGG - Intergenic
1173430715 20:42985109-42985131 GGGTCAGGACTTTGAAGAGCAGG + Intronic
1176446071 21:6821732-6821754 GTATCTAGACACTTAAGAGCAGG + Intergenic
1176824237 21:13686765-13686787 GTATCTAGACACTTAAGAGCAGG + Intergenic
1180334444 22:11563453-11563475 TTTTCAAAACTTTGAAGAGGAGG - Intergenic
1180482531 22:15767756-15767778 GTATCTAGACACTTAAGAGCAGG + Intergenic
950741263 3:15053453-15053475 GTTTCCAGATTCTGGGGAGCAGG - Exonic
955935505 3:64099228-64099250 GTTGTCAGACTCTGAAGAGGAGG + Exonic
956919668 3:73913688-73913710 GTGTCAAGAATCTGAAAAACTGG - Intergenic
957863781 3:85995755-85995777 GTTACAAGACTCAGAAGAGATGG + Intronic
959502233 3:107119485-107119507 GTTTCCAAACTCTGAAGAAAGGG - Intergenic
960283685 3:115803321-115803343 GTTTCCAGTCACTGAAGAGTAGG - Exonic
962972285 3:140413504-140413526 CTTTCAAAACACTGAAGAGGAGG + Intronic
963993363 3:151679141-151679163 TGTTCAAGACTCTGAACAGAGGG - Intergenic
964849414 3:161079437-161079459 GATTCTAGACTCTGAAGAGTGGG + Intergenic
966937079 3:184717697-184717719 GTTTCCAGACACTGAAGAGAGGG + Intergenic
969056517 4:4406009-4406031 GTTTCAAGTCCTTGAAGAGATGG - Intronic
972629298 4:40829473-40829495 GCTTCAAGTGTCTGAGGAGCTGG + Intronic
976143155 4:82014331-82014353 TTTTCAAGACAGTGGAGAGCAGG + Intronic
978331130 4:107613169-107613191 GATTCAAAACACTGAAGAGTTGG + Intronic
979075567 4:116265372-116265394 GTTACAATACTTTGAAGAGCTGG + Intergenic
980079162 4:128325489-128325511 GTTTGAAGACTGTGAAGAGAGGG - Intergenic
981368034 4:143925983-143926005 GTTTCAAGCCTTTGCATAGCTGG - Intergenic
981377826 4:144036262-144036284 GTTTCAAGCCTTTGCATAGCTGG - Intergenic
981819501 4:148869368-148869390 GTCTTTAGAATCTGAAGAGCTGG + Intergenic
982463554 4:155701977-155701999 CCTTCAAGACTTTGAATAGCTGG + Intronic
984504828 4:180603901-180603923 GTTTCACAACTCTGTAGAGGTGG + Intergenic
986450396 5:7857703-7857725 GTTTCAAGCCCCTCAAGGGCAGG + Intronic
988012842 5:25512658-25512680 CTTTCAATACTCTGTTGAGCAGG + Intergenic
990284354 5:54285664-54285686 CTTGCAGGACTCTGAAGAACTGG - Intronic
991292466 5:65045906-65045928 GTTTCAAGAATGAGTAGAGCCGG - Intergenic
991860922 5:71012472-71012494 GGGTGAAGAATCTGAAGAGCAGG - Exonic
992133690 5:73721066-73721088 GTTTTGAGAATCTGAAGAACAGG + Intronic
993301874 5:86221373-86221395 GTTTCAAGACACTGGACATCGGG + Intergenic
993328808 5:86570990-86571012 GTCTCCAGTCTCTGAAGAGAAGG - Intergenic
993449053 5:88052303-88052325 CTTTCAAGACACTGAAGAACTGG + Intergenic
993505335 5:88701948-88701970 TGTTAAAGACTCTGAAGAGAAGG + Intergenic
994362482 5:98868515-98868537 TTCTGAAGAATCTGAAGAGCTGG - Exonic
994509998 5:100690361-100690383 GGTTCATCCCTCTGAAGAGCTGG + Intergenic
994789054 5:104200809-104200831 GTTTCAAGACTATTAAGGACAGG - Intergenic
995327059 5:110902643-110902665 TTGTCAAGACTGTGAAGGGCAGG + Intergenic
996600455 5:125256607-125256629 GTTTCAAGCCTCTGAAGTTGTGG + Intergenic
997976781 5:138445690-138445712 CTTCCAAGACACTGAAGACCCGG + Exonic
998175191 5:139897527-139897549 CTTTCTAGACTGTGAGGAGCTGG + Intronic
998336040 5:141373007-141373029 GTTTCAAGACTATCAAAAGGAGG - Intronic
998642729 5:144029764-144029786 GTTTTAATACTTTGAAGAGTAGG - Intergenic
1003952762 6:11131963-11131985 TTTTCAAGACAGTGAAAAGCCGG + Intronic
1004246055 6:13977152-13977174 GTCTCAGGCCTCTGATGAGCTGG + Exonic
1004416747 6:15431587-15431609 GGTTCAAGCCTCAGAAGACCAGG + Intronic
1006649055 6:35535935-35535957 GTTGCAAGGCTCTGGAGAGCTGG + Intergenic
1009354898 6:62731194-62731216 ATTTCAAGACTAAGAAAAGCTGG - Intergenic
1009694809 6:67088544-67088566 TCATCAAGACTCAGAAGAGCAGG - Intergenic
1011767954 6:90644567-90644589 GTGTCTAGACTCTTGAGAGCTGG + Intergenic
1012958080 6:105592397-105592419 GTTTCAAGACTAGGAAGGGCTGG - Intergenic
1013993504 6:116280200-116280222 GTTTTCAGACACTGGAGAGCAGG - Intronic
1014618905 6:123640925-123640947 GATTCCATTCTCTGAAGAGCTGG + Intergenic
1015031351 6:128599741-128599763 ATTTCAAGATTCTATAGAGCAGG - Intergenic
1016862499 6:148734869-148734891 GTTTTCAGACTCTGATGATCTGG + Intergenic
1017344675 6:153367328-153367350 GTTTCAAGACACTGCACATCAGG - Intergenic
1030675118 7:112376406-112376428 ATTTCAAGTCTCTGAAGAGAAGG - Intergenic
1033124451 7:138695595-138695617 GTCTCAAGACTCACAAGAGAAGG - Intronic
1034218357 7:149424786-149424808 GTTTCAAGACTCTGAAGAGCTGG + Intergenic
1035083859 7:156239581-156239603 CTTTGAAGACTCTGAGAAGCAGG + Intergenic
1038181532 8:25233239-25233261 GTTTTCAGACACTGAACAGCAGG - Intronic
1038388648 8:27174116-27174138 GTTGCAAGTCTCTGAAGGGCTGG - Intergenic
1038880224 8:31602734-31602756 CTTTCAAGACACTGAACATCAGG - Intergenic
1044081640 8:87892615-87892637 GTTTCCAGACTCTGGAGATTTGG - Intergenic
1044302973 8:90606796-90606818 AATTCAAGTCTCTGAAAAGCAGG + Intergenic
1045414130 8:101949802-101949824 TATTCAAAACTCTGAAGAGGTGG + Intronic
1046682762 8:117190185-117190207 GTTTAAAATCTCTGTAGAGCTGG - Intergenic
1047597046 8:126388491-126388513 ATTTCAAGACACTGTACAGCAGG - Intergenic
1051389892 9:16552604-16552626 GCTTCAGGACGCTGAAGAGACGG + Exonic
1054159743 9:61665490-61665512 GTGTCAAGGCTCTGAGGATCCGG + Intergenic
1055645218 9:78356620-78356642 ATTCCTTGACTCTGAAGAGCGGG + Intergenic
1057878447 9:98775055-98775077 GTTTAGAGACTCAGAAAAGCAGG - Intronic
1061860005 9:133463204-133463226 GTTTCAGGGCTCAGAGGAGCTGG - Intronic
1203523122 Un_GL000213v1:62793-62815 GTATCTAGACACTTAAGAGCAGG - Intergenic
1188146117 X:26616083-26616105 GTTTCAAGACTCTGAAGACCTGG + Intergenic
1188742468 X:33801995-33802017 GTTTCAAGAAACTGAATAGGTGG - Intergenic
1191041208 X:56081988-56082010 GTTTCAAAACATTGAAGAGGAGG - Intergenic
1193897863 X:87135474-87135496 GTGTCAAGAGTGTGAAGAGGTGG - Intergenic
1194689840 X:96970249-96970271 GTTTCAAAACATTGAAGAGTAGG - Intronic
1194996699 X:100599023-100599045 GTTACAAGACTTTGAGGAGGAGG + Exonic
1195934984 X:110116521-110116543 GTATTGAGATTCTGAAGAGCAGG + Intronic
1197563487 X:128052136-128052158 GGTTCAGGACTCTGCAAAGCAGG - Exonic
1198066285 X:133099635-133099657 GTTTCAAGATTGTGTAGAGGTGG - Intergenic
1198648680 X:138837597-138837619 TTTTCAAAACTCTGTAGACCAGG + Intronic
1198681295 X:139185528-139185550 GCTACAAGACTATGCAGAGCAGG + Intronic
1202179086 Y:22124212-22124234 ATTTCAAGACTGTGAAGTGGTGG + Intergenic
1202212275 Y:22462182-22462204 ATTTCAAGACTGTGAAGTGGTGG - Intergenic