ID: 1034219326

View in Genome Browser
Species Human (GRCh38)
Location 7:149431921-149431943
Sequence CCCTACCACTGCGCCGAGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034219326_1034219333 14 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219333 7:149431958-149431980 GGATGCGCCGGTGTTCCAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 87
1034219326_1034219334 17 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1034219326_1034219328 -7 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219328 7:149431937-149431959 GGTAGGGCCGCTCGCCTGTGTGG 0: 2
1: 2
2: 22
3: 43
4: 131
1034219326_1034219336 26 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219336 7:149431970-149431992 GTTCCAGGAGGTGGTGCTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 581
1034219326_1034219330 2 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219330 7:149431946-149431968 GCTCGCCTGTGTGGATGCGCCGG 0: 1
1: 11
2: 23
3: 74
4: 164
1034219326_1034219332 11 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219332 7:149431955-149431977 TGTGGATGCGCCGGTGTTCCAGG 0: 1
1: 0
2: 1
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034219326 Original CRISPR CCCTACCACTGCGCCGAGTG CGG (reversed) Exonic