ID: 1034219329

View in Genome Browser
Species Human (GRCh38)
Location 7:149431944-149431966
Sequence GGCGCATCCACACAGGCGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 3, 2: 7, 3: 27, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034219329_1034219339 26 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219339 7:149431993-149432015 ATGAAGCTCTTGCCGCACTCGGG 0: 1
1: 3
2: 5
3: 25
4: 90
1034219329_1034219334 -6 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1034219329_1034219336 3 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219336 7:149431970-149431992 GTTCCAGGAGGTGGTGCTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 581
1034219329_1034219338 25 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219338 7:149431992-149432014 GATGAAGCTCTTGCCGCACTCGG 0: 1
1: 5
2: 8
3: 29
4: 82
1034219329_1034219333 -9 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219333 7:149431958-149431980 GGATGCGCCGGTGTTCCAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 87
1034219329_1034219340 27 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219340 7:149431994-149432016 TGAAGCTCTTGCCGCACTCGGGG 0: 2
1: 4
2: 13
3: 29
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034219329 Original CRISPR GGCGCATCCACACAGGCGAG CGG (reversed) Exonic