ID: 1034219334

View in Genome Browser
Species Human (GRCh38)
Location 7:149431961-149431983
Sequence TGCGCCGGTGTTCCAGGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034219329_1034219334 -6 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1034219326_1034219334 17 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034219334 Original CRISPR TGCGCCGGTGTTCCAGGAGG TGG Exonic
900379410 1:2376436-2376458 TGCCCCGGGCTTTCAGGAGGAGG + Intronic
901057449 1:6455288-6455310 GGCGCCAGTGCTCCAGGAAGAGG - Intronic
902476911 1:16693191-16693213 GGCGCCAGTGCTCCAGGAAGAGG + Intergenic
915868184 1:159528393-159528415 TGCTCCAGTGTTTCAGGTGGTGG + Intergenic
919808065 1:201392529-201392551 TCAGCCAGTGTTCCAGGAGGAGG + Intronic
919869615 1:201810599-201810621 GGCGCCGGTGCTTCAGCAGGAGG - Exonic
920920300 1:210292656-210292678 GGCACAGGTGTCCCAGGAGGGGG + Intergenic
923191865 1:231627283-231627305 GGCGCAGGTGTCCCAGGACGGGG - Intronic
1066602839 10:37126024-37126046 TGAGCCGGGGCTGCAGGAGGAGG + Intronic
1067318718 10:45198068-45198090 TGAGCCGGGGCTGCAGGAGGAGG - Intergenic
1072805278 10:98420086-98420108 CACGCTGCTGTTCCAGGAGGGGG - Exonic
1077110636 11:860581-860603 TGGGCTGGTGTTGCAGGTGGGGG + Intronic
1077785979 11:5383937-5383959 TGTGCCGGGGTTTCAGGAGTGGG + Intronic
1091216372 11:133904827-133904849 GGCACTGGTGTTTCAGGAGGGGG - Intergenic
1091536389 12:1414077-1414099 GCCGCCGCTGATCCAGGAGGCGG + Intronic
1092237841 12:6821197-6821219 TGTGTTTGTGTTCCAGGAGGAGG + Intergenic
1093077711 12:14774611-14774633 GGCGCCGGTGTACCTGGCGGCGG + Exonic
1095580187 12:43788489-43788511 TGCACCAGTGTGCCAGGATGTGG + Intronic
1098162363 12:67657708-67657730 TCCGCAGGTGTTCCAGGATTCGG - Exonic
1101524988 12:105520399-105520421 TGTGACGGTGTTTCAGGAAGAGG - Intergenic
1105223844 13:18409086-18409108 TGAGCCGGGGCTGCAGGAGGAGG + Intergenic
1114007992 14:18333912-18333934 TGAGCCGGGGCTGCAGGAGGAGG + Intergenic
1114060982 14:19015630-19015652 TGCGAGGGTGTGCCAGGAGCTGG - Intergenic
1114101275 14:19384349-19384371 TGCGAGGGTGTGCCAGGAGCTGG + Intergenic
1120768985 14:88358247-88358269 TGCCCCTGTGATCCAGGTGGAGG + Intergenic
1121238822 14:92413283-92413305 TGGGCAGGTGTTCTGGGAGGTGG - Intronic
1122142006 14:99668170-99668192 TGGGACGGTATTCCAGGTGGGGG + Intronic
1124041672 15:26111180-26111202 GGAGCCTGTGTACCAGGAGGCGG + Intergenic
1127382071 15:58438757-58438779 TGCTTCGGAGTTCCAGGAGAGGG + Intronic
1134468306 16:14498608-14498630 TGGCCTGGTGTTCAAGGAGGTGG - Intronic
1136047228 16:27624256-27624278 TGCCCCGGTGGCCCACGAGGAGG + Intronic
1136487490 16:30582781-30582803 TGCGCCGGTGACTGAGGAGGAGG + Exonic
1136550292 16:30979327-30979349 TGCGGCGGTGTGGCTGGAGGGGG - Exonic
1139747146 16:69083714-69083736 TGCCCAGGTCTTCCAGCAGGTGG + Exonic
1141969502 16:87471559-87471581 GGGGCCGGTGTTCCTAGAGGAGG - Intronic
1146058841 17:29594014-29594036 TGTGTCGGTGTTCCATGTGGTGG + Intronic
1146229195 17:31093914-31093936 TGTGCCAGTTTTCCAGGAAGAGG - Intergenic
1150353840 17:64466625-64466647 CACCCCCGTGTTCCAGGAGGTGG + Exonic
1151766403 17:76135563-76135585 TGCGCCCGTGTGCGAGGAAGTGG + Intergenic
1153829872 18:8912652-8912674 TGTGCCGGGCTGCCAGGAGGAGG - Intergenic
1154453942 18:14503707-14503729 TGCAAGGGTGTGCCAGGAGGAGG + Intergenic
1154475271 18:14748656-14748678 TGAGCCGGGGCTGCAGGAGGAGG + Intronic
1154529461 18:15330028-15330050 TGAGCCGGGGCTGCAGGAGGAGG - Intergenic
1157393285 18:47321118-47321140 AGAGAGGGTGTTCCAGGAGGAGG - Intergenic
1160242538 18:77133359-77133381 TGCGCCGGTCCTGCAGGAGAAGG - Intronic
1161943931 19:7422624-7422646 AGCCCAGGTGATCCAGGAGGTGG - Intronic
1163614494 19:18318642-18318664 TTCCCTGGTGATCCAGGAGGAGG - Intronic
1166331346 19:42079737-42079759 CTCGCCGGTGGGCCAGGAGGAGG - Exonic
1168308446 19:55449375-55449397 TGCGTCCGTGTGCCGGGAGGAGG - Intergenic
1168315043 19:55481340-55481362 TGCGCTGGTGGTGCAGGAGCCGG - Exonic
1202710926 1_KI270714v1_random:19017-19039 GGCGCCAGTGCTCCAGGAAGAGG + Intergenic
925315811 2:2922260-2922282 TGGGAGGGTGTTCCAGGTGGTGG - Intergenic
927648956 2:24899241-24899263 GGAGGCGGTGTGCCAGGAGGAGG - Intronic
927931846 2:27050470-27050492 TGCCCCGGAGCTCCAGGAGGCGG + Intronic
932619816 2:73258817-73258839 TGCTCTGCTGCTCCAGGAGGAGG + Exonic
936146538 2:109984358-109984380 GGTGCGGGTGTTCCAGGAGGTGG - Intergenic
936198152 2:110387121-110387143 GGTGCGGGTGTTCCAGGAGGTGG + Intergenic
938434096 2:131272014-131272036 TGCGAGGGTGTGCCAGGAGCCGG - Intronic
938434418 2:131274003-131274025 TGCGAGGGTGTGCCAGGAGCCGG - Intronic
938434740 2:131275993-131276015 TGCGAGGGTGTGCCAGGAGCCGG - Intronic
938434933 2:131277169-131277191 TGCAACGGTGTGCCAGGAGCCGG - Intronic
938528559 2:132161450-132161472 TGAGCCGGGGCTGCAGGAGGAGG - Intronic
943445291 2:187977866-187977888 TCCCCTGGTGTTGCAGGAGGAGG + Intergenic
947919250 2:233854913-233854935 TGCGCCGGGATCCCAGGCGGAGG - Intergenic
1170365298 20:15591473-15591495 TGCCCCTCTGTCCCAGGAGGAGG + Intronic
1174488186 20:50874311-50874333 AGGGCCGGTGTTCCAGGCCGAGG - Intronic
1176767937 21:13038440-13038462 TGAGCCGGGGCTGCAGGAGGAGG + Intergenic
1179512703 21:41884475-41884497 TGTGCTGATGCTCCAGGAGGAGG - Intergenic
1180432499 22:15264722-15264744 TGAGCCGGGGCTGCAGGAGGAGG + Intergenic
1180479463 22:15738242-15738264 TGCGAGGGTGTGCCAGGAGCTGG - Intergenic
1180515071 22:16132702-16132724 TGAGCCGGGGCTGCAGGAGGAGG + Intergenic
1180788139 22:18558332-18558354 TGCACTGGTGTGCCAGGAGCAGG + Intergenic
1181155422 22:20917273-20917295 CGCTCCCGCGTTCCAGGAGGAGG - Intergenic
1181233599 22:21436986-21437008 TGCACTGGTGTGCCAGGAGCAGG - Intronic
1181245051 22:21497857-21497879 TGCACTGGTGTGCCAGGAGCAGG + Intergenic
1182598439 22:31440739-31440761 TGCAGAGGTGTTCCAGGACGAGG + Exonic
1184247010 22:43240888-43240910 TGTGCCTGTTTTCCAGGTGGAGG + Intronic
974847448 4:67367906-67367928 TGTGCCTGTCTTCCAGGATGAGG - Intergenic
976596356 4:86898729-86898751 AGCCCAGGAGTTCCAGGAGGTGG + Intronic
978398128 4:108304207-108304229 TGGTCCTGTGTTACAGGAGGTGG + Intergenic
981577878 4:146223710-146223732 TGCGCAAGCGTTCCCGGAGGTGG - Intergenic
996315137 5:122152881-122152903 TTCTCTGGTGTACCAGGAGGCGG - Exonic
998544033 5:143010703-143010725 TGCTTGGGTGTTCCAGGAAGGGG + Intronic
1003254241 6:4460220-4460242 TGGGCCCGGGTCCCAGGAGGAGG + Intergenic
1005466887 6:26124373-26124395 CGCGCCGGTGTACCTGGCGGCGG + Exonic
1005482987 6:26272393-26272415 TGCGCCGGTGTACCTGGAGGCGG - Intergenic
1005642372 6:27808350-27808372 AGCGCCGGTGTACCTGGCGGCGG + Exonic
1005642976 6:27814578-27814600 AGCGCCGGTGTACCTGGCGGCGG - Exonic
1005645898 6:27838177-27838199 AGCGCCGGTGTACCTGGCGGCGG - Exonic
1005648559 6:27865495-27865517 CGCGCCGGTGTACCTGGCGGCGG + Exonic
1005844764 6:29768819-29768841 TGCCCAGGGGTTCCTGGAGGAGG - Intergenic
1006263446 6:32895554-32895576 AGCGCCGGTCTTGCAGGATGGGG - Intergenic
1007463690 6:42036529-42036551 TGCGCCTGTAGACCAGGAGGAGG - Intronic
1016466636 6:144332038-144332060 GGGGCCGGTATTCCAGGTGGAGG - Intronic
1017042007 6:150315365-150315387 TGCACAGGAGGTCCAGGAGGGGG + Intergenic
1019322187 7:420822-420844 TGGGCCAGTGCTCCTGGAGGAGG - Intergenic
1019473423 7:1233029-1233051 CATGCGGGTGTTCCAGGAGGCGG - Exonic
1024104647 7:46070411-46070433 TGTGCCTGTGTGCCAGTAGGGGG + Intergenic
1024300619 7:47884850-47884872 TGCCCCGGGGCCCCAGGAGGAGG + Intronic
1031026555 7:116685999-116686021 TCCAGTGGTGTTCCAGGAGGGGG - Intronic
1032397910 7:131603968-131603990 TGCCCCAGTGTTCCCTGAGGGGG - Intergenic
1034186255 7:149179528-149179550 TGCGCTGGTGTTTCATTAGGTGG - Exonic
1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG + Exonic
1037272723 8:17147050-17147072 AGTGCTGGTGTTCCAGGCGGGGG + Intergenic
1039443577 8:37612568-37612590 AGAGCAGGTGTTTCAGGAGGTGG + Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1048521338 8:135158209-135158231 GGCTCTCGTGTTCCAGGAGGTGG - Intergenic
1049232592 8:141492272-141492294 TCCGTCTGTGTCCCAGGAGGCGG + Intergenic
1049442098 8:142614275-142614297 TGCGCAGGTGCTCCGGCAGGCGG + Exonic
1049536874 8:143186505-143186527 TGCCCAGGTGTCCCAGGAGGGGG + Intergenic
1049672407 8:143875881-143875903 TGTGCGTGTGTCCCAGGAGGTGG + Intronic
1053707177 9:40767790-40767812 TGAGCCGGGGCTGCAGGAGGAGG - Intergenic
1054417090 9:64888558-64888580 TGAGCCGGGGCTGCAGGAGGAGG - Intergenic
1054738492 9:68780305-68780327 TTCGCCGGTGTTCCAGGCCGAGG + Exonic
1056762618 9:89425896-89425918 TGCCCTGGTGTCCCTGGAGGAGG - Intronic
1059314232 9:113410467-113410489 TGCGCCGGTATTTGAGGCGGAGG - Intronic
1059408341 9:114116318-114116340 TGGGCAGGTGTCCCAGGAGAGGG + Intergenic
1059786568 9:117592780-117592802 TGTGCCTGTGCTCCAGGAGAAGG + Intergenic
1060522209 9:124300361-124300383 CACGGGGGTGTTCCAGGAGGTGG - Intronic
1060527461 9:124328525-124328547 TGGGGCGGTGTTCAAGGAGGCGG - Intronic
1061163966 9:128911802-128911824 GGCTCTGGTGTTCCAGGGGGTGG - Intronic
1061728776 9:132597239-132597261 TGCACCAGTGTCCCTGGAGGAGG + Intronic
1061962335 9:133994392-133994414 TGCGCCGGCGGTCCAGGCGAGGG - Intergenic
1203785884 EBV:127366-127388 TGCGCAGGTGGGCCAGGAGAAGG - Intergenic
1191213098 X:57909688-57909710 TGCTCCGGCGCCCCAGGAGGAGG - Exonic
1192207019 X:69103051-69103073 TGCCCCTGTGTTCCAGGAAGTGG - Intergenic
1192348302 X:70331697-70331719 TGTGCCTGTATTCCAGGATGAGG + Intronic
1192435044 X:71137863-71137885 TGGGCCGCTGTTGCAGGTGGCGG - Exonic
1200083664 X:153592254-153592276 GTCGCCGGTGTCCCGGGAGGAGG - Intronic