ID: 1034219334

View in Genome Browser
Species Human (GRCh38)
Location 7:149431961-149431983
Sequence TGCGCCGGTGTTCCAGGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034219329_1034219334 -6 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 119
1034219326_1034219334 17 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034219334 Original CRISPR TGCGCCGGTGTTCCAGGAGG TGG Exonic