ID: 1034219336

View in Genome Browser
Species Human (GRCh38)
Location 7:149431970-149431992
Sequence GTTCCAGGAGGTGGTGCTTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 581}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034219326_1034219336 26 Left 1034219326 7:149431921-149431943 CCGCACTCGGCGCAGTGGTAGGG 0: 1
1: 1
2: 4
3: 46
4: 187
Right 1034219336 7:149431970-149431992 GTTCCAGGAGGTGGTGCTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 581
1034219331_1034219336 -4 Left 1034219331 7:149431951-149431973 CCTGTGTGGATGCGCCGGTGTTC 0: 1
1: 2
2: 16
3: 38
4: 144
Right 1034219336 7:149431970-149431992 GTTCCAGGAGGTGGTGCTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 581
1034219329_1034219336 3 Left 1034219329 7:149431944-149431966 CCGCTCGCCTGTGTGGATGCGCC 0: 1
1: 3
2: 7
3: 27
4: 106
Right 1034219336 7:149431970-149431992 GTTCCAGGAGGTGGTGCTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034219336 Original CRISPR GTTCCAGGAGGTGGTGCTTG CGG Exonic