ID: 1034219367

View in Genome Browser
Species Human (GRCh38)
Location 7:149432198-149432220
Sequence CGTGCACGCGGGCAAGCATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034219367_1034219375 30 Left 1034219367 7:149432198-149432220 CCTCATGCTTGCCCGCGTGCACG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1034219375 7:149432251-149432273 CGGAAGCTCTTCTTGCACTCGGG 0: 1
1: 0
2: 3
3: 6
4: 99
1034219367_1034219371 7 Left 1034219367 7:149432198-149432220 CCTCATGCTTGCCCGCGTGCACG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1034219371 7:149432228-149432250 GGATCACCAAGCTGATGTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 91
1034219367_1034219372 10 Left 1034219367 7:149432198-149432220 CCTCATGCTTGCCCGCGTGCACG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1034219372 7:149432231-149432253 TCACCAAGCTGATGTGCAGGCGG 0: 1
1: 0
2: 0
3: 27
4: 255
1034219367_1034219374 29 Left 1034219367 7:149432198-149432220 CCTCATGCTTGCCCGCGTGCACG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1034219374 7:149432250-149432272 GCGGAAGCTCTTCTTGCACTCGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034219367 Original CRISPR CGTGCACGCGGGCAAGCATG AGG (reversed) Exonic