ID: 1034219807

View in Genome Browser
Species Human (GRCh38)
Location 7:149435169-149435191
Sequence CTCAAAAATATGTACATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 2, 1: 0, 2: 5, 3: 74, 4: 696}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034219807_1034219812 27 Left 1034219807 7:149435169-149435191 CCATATATGTACATATTTTTGAG 0: 2
1: 0
2: 5
3: 74
4: 696
Right 1034219812 7:149435219-149435241 GGAGTGCAGTGATACAATCATGG 0: 16
1: 791
2: 7728
3: 46044
4: 113055
1034219807_1034219808 2 Left 1034219807 7:149435169-149435191 CCATATATGTACATATTTTTGAG 0: 2
1: 0
2: 5
3: 74
4: 696
Right 1034219808 7:149435194-149435216 AGTGTCTTGCTCTGTCACCCAGG 0: 293
1: 14401
2: 50532
3: 112523
4: 166340
1034219807_1034219809 6 Left 1034219807 7:149435169-149435191 CCATATATGTACATATTTTTGAG 0: 2
1: 0
2: 5
3: 74
4: 696
Right 1034219809 7:149435198-149435220 TCTTGCTCTGTCACCCAGGCTGG 0: 26457
1: 73050
2: 147182
3: 159645
4: 143243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034219807 Original CRISPR CTCAAAAATATGTACATATA TGG (reversed) Intronic
900012102 1:123230-123252 CCCAAGAATATGTACAATTATGG + Intergenic
900042162 1:479241-479263 CCCAAGAATATGTACAATTATGG + Intergenic
900063600 1:714187-714209 CCCAAGAATATGTACAATTATGG + Intergenic
900909535 1:5585141-5585163 CTCTAAACTGTGTAGATATAAGG - Intergenic
901100933 1:6718112-6718134 TTAAAAAATATATATATATATGG + Intergenic
903641665 1:24864184-24864206 CTCAAACATATGCACACACACGG - Intergenic
903972278 1:27126797-27126819 CCCAAAAATATATACACAAAAGG - Intronic
906563763 1:46781227-46781249 TTCAAAACCATGTAAATATATGG - Intronic
908306114 1:62818872-62818894 TTCAAAAATAGGTAAATACATGG - Intronic
908341294 1:63182410-63182432 CCCATATATATGTACATATGTGG + Intergenic
908820066 1:68077317-68077339 CTCAAAACCATGCAAATATATGG - Intergenic
909071364 1:70997333-70997355 CTTAAAAATATATACATAACAGG + Intronic
909243317 1:73242850-73242872 CTCAAAACTATGCAAATATATGG + Intergenic
909266674 1:73568458-73568480 TTCAAAAAGATATACATATAAGG + Intergenic
909947681 1:81682085-81682107 CACATATATATGTATATATATGG - Intronic
910116544 1:83737836-83737858 TTCATATACATGTACATATATGG + Intergenic
910438916 1:87232409-87232431 CACATATATATGTATATATATGG + Intergenic
910664123 1:89705776-89705798 CTCAAAAATAAATAAATAAATGG + Intronic
911509845 1:98798175-98798197 CCCCAAAATATGTACAACTATGG - Intergenic
911589947 1:99735666-99735688 CTCAAAAATGTTTACAAAAAAGG - Intronic
911655853 1:100443333-100443355 CTCAAAAATAAATAAATAAAAGG - Intronic
912005298 1:104891574-104891596 CTTAAAAATATTTACATAAAGGG + Intergenic
913499216 1:119455222-119455244 CCCAAACATATATATATATAGGG + Intergenic
913976632 1:143463418-143463440 TTTAAAAAAATGTACAAATATGG - Intergenic
914071033 1:144289035-144289057 TTTAAAAAAATGTACAAATATGG - Intergenic
914108122 1:144677320-144677342 TTTAAAAAAATGTACAAATATGG + Intergenic
914891664 1:151629885-151629907 CAAAAAAATATATATATATATGG - Intronic
915066693 1:153230914-153230936 CTCTCAAATATGTACATTTTTGG - Intergenic
915999709 1:160603499-160603521 CTCAAAACTATGCAAATATATGG - Intergenic
916948317 1:169753359-169753381 ATAAAAAATACGTGCATATAAGG + Intronic
919957081 1:202428267-202428289 CTAGAAAATCAGTACATATATGG - Intronic
920575343 1:207055354-207055376 CTCAAAAAAATGAACCTATAGGG - Intronic
920894884 1:210037726-210037748 CTCAAAACTATACAAATATATGG - Intronic
921662777 1:217826808-217826830 CTTAAAATTATGTACCTATCTGG - Intronic
921680507 1:218025619-218025641 CACAAATGTATGTACATATGTGG + Intergenic
921810404 1:219506113-219506135 CCCACAAATAAGTAAATATATGG + Intergenic
921826648 1:219679482-219679504 TTCAACAATATGTACAAAAAAGG + Intergenic
921974498 1:221187229-221187251 CTAAATGATATGTACATATTTGG + Intergenic
922023327 1:221726489-221726511 CTGAAAAACATGCACATATATGG + Intronic
922260529 1:223939705-223939727 CCCAAGAATATGTACAATTATGG + Intergenic
922347382 1:224707711-224707733 CTCAAAATAATGTGCATACAAGG - Intronic
922733143 1:227963228-227963250 CCCAAGAATATGTACAATTATGG - Intergenic
923074182 1:230594656-230594678 CTCAAATATATGTAAATCTTAGG + Intergenic
923481470 1:234389287-234389309 ATCATAGATATGTACATACATGG + Intergenic
923605671 1:235440388-235440410 CAAAAAAATATATATATATACGG - Intronic
924341705 1:243041904-243041926 CCCAAGAATATGTACAATTATGG + Intergenic
924572721 1:245252315-245252337 CTATATAATATGTTCATATATGG - Intronic
924691777 1:246358664-246358686 CTCAAAACCATGCAAATATATGG + Intronic
924805800 1:247360618-247360640 CTCAAAAAAATGAAAATATCAGG + Intergenic
924879907 1:248149606-248149628 CTCAAAAACATGCAAATATATGG - Intergenic
1063027139 10:2191520-2191542 ATGAAAAATATATATATATAAGG - Intergenic
1063505807 10:6598572-6598594 CCTAAAAATATGTACAGCTATGG - Intergenic
1063729754 10:8682895-8682917 GTGAAAAATACCTACATATATGG - Intergenic
1064229663 10:13519092-13519114 CACAAAAATAAGTAAATATTAGG + Intronic
1064238174 10:13596937-13596959 CTTAAAATAATCTACATATAGGG - Intronic
1064701824 10:18029890-18029912 GGAAAAAATATATACATATATGG + Intronic
1064770683 10:18719323-18719345 CCCAGAAATAAATACATATAAGG - Intergenic
1065156956 10:22880540-22880562 CTCAAAATTATGCAAATACATGG - Intergenic
1066267472 10:33790382-33790404 TTTAAAAATATGTACATTTCAGG - Intergenic
1066602919 10:37126323-37126345 CACAAAATTAAGTACATACAGGG + Intronic
1066734771 10:38463652-38463674 CCCAAGAATATGTACAATTATGG - Intergenic
1067245955 10:44543999-44544021 CTCAAAACTATATAAGTATATGG - Intergenic
1067318646 10:45197768-45197790 CACAAAATTAAGTACATACAGGG - Intergenic
1068231667 10:54175413-54175435 CTCAGAAGTATATACAGATAAGG + Intronic
1068743923 10:60507099-60507121 TACACAAATATATACATATATGG + Intronic
1068952553 10:62791504-62791526 CCCCAAAAAATATACATATAGGG - Intergenic
1070208528 10:74289430-74289452 CTCAAAACTATGTGAATATTTGG + Intronic
1070454257 10:76594734-76594756 CTCAAAACTATGCAAATATGTGG - Intergenic
1070864302 10:79697163-79697185 CACGTATATATGTACATATATGG - Intergenic
1070920529 10:80182706-80182728 AAAAAAATTATGTACATATATGG - Intronic
1071534586 10:86417368-86417390 CTCAAAAATAAGTAAATACATGG - Intergenic
1071542715 10:86502278-86502300 CTCTACATTATGTACAGATATGG + Intronic
1071631201 10:87219390-87219412 CACGTATATATGTACATATATGG - Intergenic
1072159121 10:92749946-92749968 CTCAAAAATAAATAAATAAAGGG - Intergenic
1072179068 10:92962376-92962398 GTTAAAAATATATATATATATGG + Intronic
1072191115 10:93076800-93076822 CTGAAACATATCTCCATATAGGG - Intronic
1072194064 10:93100035-93100057 CCCAGAAATAGGCACATATATGG - Intergenic
1074601586 10:114919199-114919221 CTTAAAGTTATGTACAAATATGG - Intergenic
1074755810 10:116623298-116623320 TTCAAAAAAATGTGCATAAAAGG + Intronic
1075365150 10:121880620-121880642 CTTAAGAATATGTAAAAATAGGG - Intronic
1076270226 10:129146144-129146166 GTCAAAAATCTGCACATATCTGG + Intergenic
1076968433 11:115442-115464 CCCAAGAATATGTACAATTATGG + Intergenic
1077619586 11:3708587-3708609 TTCAACAAAATTTACATATAGGG - Intronic
1078528596 11:12119437-12119459 CTCTAAAATCAGGACATATAAGG - Intronic
1079179734 11:18180127-18180149 CTCAAAACGATGAAAATATATGG + Intronic
1079860594 11:25665766-25665788 ATCAAATATATGTAAAGATAGGG - Intergenic
1080502218 11:32881791-32881813 CTCAAGAATTTGTATATATTTGG + Intergenic
1080509116 11:32949633-32949655 CACAAAAATATGTATGTAAATGG - Intronic
1081151762 11:39641213-39641235 CCAAAAAATATATATATATATGG + Intergenic
1083190332 11:61047224-61047246 CTCAAACATACATACATATTAGG + Intergenic
1083942547 11:65904649-65904671 CTCAAAAATAAATAAATAAATGG - Intergenic
1084723630 11:70925953-70925975 GTCAACAATATGTATAAATAAGG - Intronic
1085700837 11:78744670-78744692 CTCAAAAATGTTTACAGAAAGGG - Intronic
1086625115 11:88941359-88941381 CTCATTATTATGTATATATATGG - Intronic
1086698861 11:89876421-89876443 ATTAAAAATATGTACATGTTTGG + Intergenic
1086707310 11:89968078-89968100 ATTAAAAATATGTACATGTTTGG - Intergenic
1086886263 11:92209405-92209427 CAGAGACATATGTACATATATGG - Intergenic
1087318757 11:96635209-96635231 CTTATATATATGTATATATAAGG - Intergenic
1087446097 11:98255164-98255186 CTCAAAAATAGGTACATAATAGG + Intergenic
1087570018 11:99914527-99914549 TTCAAATATATGTACCTACAAGG - Intronic
1087577170 11:100003794-100003816 CTCAAAAGTAAATACATAAAAGG + Intronic
1087690312 11:101313648-101313670 CTCAAAAACATGAATATAGAAGG - Intergenic
1088138649 11:106588569-106588591 TTCAAAAGTTTGTACATGTATGG + Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1090045785 11:123331722-123331744 CTTTAAAATATTTACGTATATGG - Intergenic
1090682912 11:129080452-129080474 CTCAAAACTATGCAAATACATGG + Intronic
1092668423 12:10833300-10833322 CACAGATATAGGTACATATATGG + Intronic
1092811749 12:12277067-12277089 CTCAAAAATAAATAAATAAATGG + Intergenic
1092919866 12:13221855-13221877 CTTTCAAATATGTAGATATATGG - Intergenic
1092978297 12:13767759-13767781 CTCAAAAATATGAACAAAAGAGG - Intronic
1093128963 12:15366627-15366649 CTCAAAAATAAGTATTAATATGG - Intronic
1093290360 12:17312416-17312438 CTCAAGTCTATGTACATATTTGG - Intergenic
1093533683 12:20198290-20198312 CTCAAAACTATACAAATATATGG - Intergenic
1093534651 12:20209346-20209368 CATAAAAATATGTACCTATGGGG + Intergenic
1093665952 12:21812866-21812888 CTCTAAAAAATATACATATTTGG + Intronic
1093985601 12:25528854-25528876 CTCAAGGATATGTACCTATTTGG - Intronic
1094621280 12:32082871-32082893 CTCAAAAATATATATATATTTGG - Intergenic
1095607269 12:44084349-44084371 CTTAAAAAAATCTACAGATATGG - Intronic
1095774463 12:45997163-45997185 CTCAAAAAAATATATATATATGG - Intergenic
1095774502 12:45997551-45997573 TTAAAAAAGATATACATATAAGG - Intergenic
1095784718 12:46097008-46097030 CTCAAAACTATGCAAATACATGG + Intergenic
1095831705 12:46594053-46594075 CTGAAAAATATAGAAATATATGG - Intergenic
1096270559 12:50163197-50163219 CTCAAAAATAAATAAATATTGGG - Intronic
1096281928 12:50262816-50262838 CTCAAAAATAAGTAAGTAAAGGG + Intronic
1096667353 12:53174789-53174811 TTCAAAAATATATATATATATGG + Intronic
1096727098 12:53573238-53573260 TTCATAGGTATGTACATATAGGG + Intronic
1096912968 12:55002546-55002568 GACAGAAATATGTCCATATAAGG - Intergenic
1096990565 12:55798495-55798517 CTCAAAAATAAATAAATAAAGGG + Intronic
1097135921 12:56855386-56855408 CTCAAAAATATATTGAAATAGGG - Intergenic
1097523217 12:60695686-60695708 CCCTTAAATATGTACAAATATGG - Intergenic
1097603795 12:61728005-61728027 CTCAAAAGTATGCAAATACATGG - Intronic
1097607351 12:61771579-61771601 CTCAAAATTATGCAAATACATGG + Intronic
1097676816 12:62611802-62611824 CTAAAATATATATATATATAAGG + Intergenic
1097813906 12:64050454-64050476 TTTAAAAATGTGTATATATAGGG - Intronic
1098024508 12:66188350-66188372 CAGATAAAAATGTACATATATGG - Intergenic
1098646376 12:72906806-72906828 CTGAAAAATAGATACATATGTGG + Intergenic
1098716780 12:73837790-73837812 GTTAAAAATAGGTACATATATGG - Intergenic
1099383845 12:81989779-81989801 CCCAATAATATGTACTTATAGGG - Intergenic
1099508043 12:83502857-83502879 CTTAAAAATATGTTCACTTAAGG + Intergenic
1099759546 12:86899582-86899604 CTTAAAAAAATTTAAATATATGG - Intergenic
1100061483 12:90581881-90581903 CTTAAAAATATTGACATGTAAGG - Intergenic
1100546688 12:95609701-95609723 CTCAAAAAAAAGAATATATAAGG + Intergenic
1100626682 12:96341524-96341546 ATCAACAATAAGTACATAAAAGG + Intronic
1101125653 12:101631265-101631287 TTCATATATATGGACATATATGG - Intronic
1102849472 12:116226417-116226439 TTCAAAAATATTTACATAGATGG + Intronic
1103102483 12:118190931-118190953 CTCAAAAACATGTACAACCATGG + Intronic
1103383095 12:120510271-120510293 AGGAAAAATATGTATATATAAGG - Intronic
1103383447 12:120513098-120513120 CTTTAAAATATATACATATTTGG - Intronic
1103558541 12:121780055-121780077 CTCAAAAATAAATAAATAAAAGG - Exonic
1104120610 12:125795638-125795660 TTTAAAAATATGTAGATATATGG + Intergenic
1105222601 13:18346401-18346423 TTAAAAAAAATGTACAAATATGG + Intergenic
1105598636 13:21864758-21864780 CTCAAAACCATGCAAATATATGG - Intergenic
1106406174 13:29476309-29476331 CACATACATATATACATATATGG - Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1107961099 13:45559685-45559707 CTCAAAACCATGCAAATATATGG - Intronic
1108191267 13:47941644-47941666 CACACATATATTTACATATATGG + Intronic
1108936992 13:55894043-55894065 CTCAAAAGTATGTATTTATCTGG + Intergenic
1109222075 13:59650491-59650513 CAAAAAAATATATATATATATGG + Intergenic
1109325468 13:60862074-60862096 CTCAAAAATATTTATAAATGTGG + Intergenic
1109580159 13:64320190-64320212 CTGAAACATATGTAAACATAGGG - Intergenic
1109753846 13:66732681-66732703 CTCCAAATTATGTTCATGTAAGG + Intronic
1109811932 13:67524848-67524870 CTAAATAATATGTACAAATGGGG + Intergenic
1109906043 13:68843892-68843914 CACATATATATGTATATATATGG - Intergenic
1109975869 13:69830798-69830820 CTCAAAATCATGCACATAGATGG + Intronic
1110088935 13:71420189-71420211 CTCAAAATTATAAACATACATGG - Intergenic
1110326302 13:74219496-74219518 CATAAAAAGATGTACATACAAGG - Intergenic
1110357962 13:74590271-74590293 CTCAAAGATAGGTACATAGGAGG + Intergenic
1110677704 13:78269215-78269237 ATAAAAACTGTGTACATATAAGG + Intergenic
1110927260 13:81169435-81169457 TACAGAAATATGTAAATATAAGG - Intergenic
1110982983 13:81926007-81926029 ATCAAAAATATATCCATATCAGG - Intergenic
1111040950 13:82746549-82746571 TTCAAAAACATGTATATACATGG + Intergenic
1111356538 13:87113027-87113049 ATGGCAAATATGTACATATAAGG + Intergenic
1111495474 13:89043649-89043671 AACATATATATGTACATATATGG - Intergenic
1111693125 13:91590401-91590423 CTGGAAAACATGAACATATATGG + Intronic
1111819762 13:93197955-93197977 CTCAAAACTATACAAATATATGG - Intergenic
1112217297 13:97446298-97446320 CTCAAAAATATATGCACAAATGG - Intronic
1112591082 13:100763488-100763510 ATCAAAAATAAGTACATAGGAGG + Intergenic
1112824464 13:103375963-103375985 ATCAAGAAAATGTACATATACGG + Intergenic
1112949027 13:104967889-104967911 CTCTTAAATATGTGCATAAATGG - Intergenic
1113381929 13:109812435-109812457 CTCATAAATATATACACCTACGG + Intergenic
1114138616 14:19884565-19884587 TTCAAAAAAATATATATATATGG + Intergenic
1114715967 14:24825153-24825175 CCCAAACATATTTACTTATAGGG + Intronic
1114876245 14:26722641-26722663 TTTTAAAATATGTACATATGTGG + Intergenic
1115176554 14:30568544-30568566 CTAAAAAATATGTGCAGAAAAGG - Intronic
1115384011 14:32774791-32774813 CTGAAAAATATAAACATATAAGG - Intronic
1115513529 14:34161903-34161925 TTCAAAAATATGTAAGAATATGG + Intronic
1115644536 14:35359149-35359171 CTCAAAAATATACATGTATATGG + Intergenic
1116497424 14:45578720-45578742 CTCAAAAAACTGCATATATAAGG - Intergenic
1118830213 14:69424179-69424201 CTCAAGAATATCTTCATAAAGGG - Exonic
1119014284 14:71033347-71033369 TTCCAAAATACGTACATAAAAGG + Intronic
1120099880 14:80432774-80432796 ATTAAAAATATGTACAAAAAAGG + Intergenic
1120286736 14:82511842-82511864 CGCATATATATATACATATATGG + Intergenic
1120662913 14:87271648-87271670 CTTACAAATATGTAGATTTATGG + Intergenic
1120785514 14:88531139-88531161 CTCAAAACTATATAAATAAATGG + Intronic
1121478786 14:94242001-94242023 CTTTAAAATATGTGCATAGATGG + Intronic
1122160217 14:99778407-99778429 CAGAAAAAGATTTACATATAAGG - Intronic
1122541712 14:102501541-102501563 CTCAAAAATAAATAAATAGAAGG + Exonic
1124024645 15:25954160-25954182 CTTAAAGATATGGAGATATATGG - Intergenic
1125320587 15:38483843-38483865 CTCATACATATGTACAATTATGG - Intronic
1125531703 15:40417857-40417879 CTCATAAGTATGTATGTATAGGG + Intronic
1126244801 15:46491933-46491955 CTCAAAACTATGCAAATACAAGG + Intergenic
1126402779 15:48291246-48291268 CTCACATATATATATATATATGG - Intronic
1126597508 15:50397113-50397135 CTTTTAAATATTTACATATATGG + Intergenic
1126601136 15:50428536-50428558 ATCATAAAAATGTATATATAGGG - Intronic
1127090462 15:55461487-55461509 CTCAAAACTATACAAATATATGG + Intronic
1127350363 15:58145507-58145529 TTAAAAAATATATATATATATGG - Intronic
1129225295 15:74166901-74166923 CTTTAAAATATTTACACATATGG + Intergenic
1129316136 15:74745784-74745806 CTCAAAAATAAATAAATAAATGG - Intergenic
1129861579 15:78867079-78867101 CACATAAATATGTCAATATAAGG + Intronic
1130242376 15:82207607-82207629 TTAAAAAATATGCATATATATGG + Intronic
1130405391 15:83596161-83596183 CTGAAAAATATCCACATATGTGG - Intronic
1130458010 15:84133244-84133266 TTTAAAAATATGCACATATATGG - Intergenic
1131004820 15:88968868-88968890 CTCAAAATTATACAAATATATGG - Intergenic
1131330381 15:91493070-91493092 CTAAAAAATATATATATATTTGG - Intergenic
1131362350 15:91804716-91804738 CTCAAAAATGAGACCATATAGGG - Intergenic
1132158619 15:99515454-99515476 CTCAAAAATAAATAAATAAATGG - Intergenic
1133657166 16:7876945-7876967 CACAAAAATCTGTACATGAATGG - Intergenic
1135273929 16:21094663-21094685 CTCAAATATATATATATATATGG + Intronic
1135589230 16:23693284-23693306 CTCAAAAATATATATATATAGGG + Intronic
1135708786 16:24697682-24697704 CTCAAAAACAAGTAAAAATATGG + Intergenic
1137244988 16:46694991-46695013 AACAAAAGTATGTGCATATACGG + Intronic
1137414930 16:48267298-48267320 CTCAAAAATATATATATGAATGG - Intronic
1137678988 16:50322304-50322326 CTTATAAATATGTAAATAAATGG + Intronic
1137749179 16:50846243-50846265 CTCAAATATATGTCTATATTTGG - Intergenic
1138710505 16:58965487-58965509 CTCTAAAATATGTATGTACAGGG - Intergenic
1139132170 16:64159584-64159606 CTCATAAATATGTACAACTTTGG - Intergenic
1140088519 16:71817952-71817974 CTCGAAAATATGTATAAATGTGG + Intergenic
1140159189 16:72468230-72468252 CATAAACATATATACATATATGG - Intergenic
1140223633 16:73062269-73062291 CACAAAAATATATGCATAAAGGG + Intergenic
1140632374 16:76869523-76869545 TTTAAAACTATGTAGATATATGG + Intergenic
1140872526 16:79120359-79120381 CTCAAAAGTAGGTACAGATGGGG + Intronic
1141095168 16:81158088-81158110 CTCAAAAAAATACATATATATGG + Intergenic
1141179286 16:81741460-81741482 CCCATAAATATGTACAAATTGGG - Intronic
1141233296 16:82191426-82191448 TTCAAAAATATATATATATTAGG - Intergenic
1142452243 16:90183684-90183706 CCCAAGAATATGTACAATTATGG - Intergenic
1143047252 17:4091774-4091796 CTCAAAAAAATATAAAAATAAGG + Intronic
1144275606 17:13665656-13665678 CACACAAATATATACATATTAGG - Intergenic
1145034447 17:19531034-19531056 GTCATAAGTATGTTCATATACGG - Intronic
1145815402 17:27791800-27791822 AACAAAAATATATATATATATGG + Intronic
1146537441 17:33665299-33665321 CTCAAAAGTATGTACTGATGGGG + Intronic
1146612883 17:34323414-34323436 CTCAAAACCATGCAAATATATGG - Intergenic
1146981757 17:37169028-37169050 TACAAACATATGTACATAAAAGG + Intronic
1146987452 17:37233906-37233928 TTAAAAAATATGTAATTATAGGG - Intronic
1147285022 17:39395421-39395443 CTCAAAAATAAATAAATAAAAGG + Intronic
1147454055 17:40524043-40524065 CTCAAAAATATGCACAGAGATGG - Intergenic
1148400347 17:47354168-47354190 CTCAAAACTATGCAAATACAGGG - Intronic
1148727210 17:49802211-49802233 CACCAAAATATGTACATACAAGG - Intronic
1149133629 17:53339061-53339083 CTCAAAATTATGCCCTTATATGG + Intergenic
1149245973 17:54708406-54708428 CTCAAAAATATTATCATAAATGG + Intergenic
1150282360 17:63936484-63936506 CTCAAAATTATACAAATATATGG - Intergenic
1150353375 17:64462946-64462968 ATAAAAAATATGTATATATTAGG - Intronic
1151357028 17:73565263-73565285 CTCTGAAATATGTACACATGGGG + Intronic
1151573643 17:74940130-74940152 CACATACATATATACATATATGG + Intronic
1153532690 18:6065022-6065044 CTCAAAAAAATACACATAGAAGG - Intronic
1153879990 18:9413527-9413549 CTCAAAAAAATATATATATTTGG + Intergenic
1154137941 18:11796953-11796975 CTCAAAAATAAGTTCTGATAGGG - Intronic
1154475350 18:14748955-14748977 CACAAAATTAAGTACATACAGGG + Intronic
1154942087 18:21124283-21124305 CTAAAAAATATATGTATATATGG - Intergenic
1155105333 18:22659380-22659402 CTCAAAATTATGTAAATACATGG + Intergenic
1155573595 18:27221457-27221479 CTCAAAACTATGCAAATATATGG - Intergenic
1155711135 18:28880966-28880988 CACAAAAACATGTACACAAATGG - Intergenic
1155743571 18:29321433-29321455 TTCAAAAATATATATATTTATGG + Intergenic
1155871543 18:31035317-31035339 CACAAAAATATGGACAAATAGGG + Intronic
1155931249 18:31711135-31711157 CTTAAAAATTTGTACAAAAATGG + Intergenic
1156556796 18:38077335-38077357 CAGAAAAATCTGTAAATATATGG - Intergenic
1156649290 18:39205477-39205499 CTGGAAAATATGTATATTTATGG - Intergenic
1156701011 18:39824857-39824879 AACAAAAATATGAACATAGAGGG + Intergenic
1157044156 18:44077384-44077406 TTCAAATATATGAAAATATAAGG - Intergenic
1157471913 18:47995327-47995349 CATAAAAATATGTACATATATGG - Intergenic
1158014984 18:52773828-52773850 TTAAAAAATATATATATATATGG - Intronic
1158681550 18:59571699-59571721 ATGGAAAATCTGTACATATATGG + Intronic
1159098168 18:63929187-63929209 GGAAAAAATATATACATATATGG - Intronic
1159153189 18:64546891-64546913 CTCAAAAGAAGGTATATATATGG - Intergenic
1159257813 18:65971242-65971264 CTCATGATTTTGTACATATAAGG - Intergenic
1159295911 18:66488341-66488363 CACATATATATGTACATACATGG - Intergenic
1159377134 18:67606744-67606766 CTCATACATATGTATATATCTGG - Intergenic
1159419131 18:68193332-68193354 CTCAAAACTATATAAATATATGG - Intergenic
1159651028 18:70979304-70979326 CTCAAAAATATTGACATTTTAGG + Intergenic
1159702180 18:71642116-71642138 GGTAAAAATATGTAAATATAAGG - Intergenic
1159843080 18:73423747-73423769 CTCACAAATAAGGTCATATAAGG + Intergenic
1160162540 18:76484773-76484795 CTTTAAAATATGTAAATATTAGG + Intronic
1160645241 19:185382-185404 CCCAAGAATATGTACAATTATGG + Intergenic
1160801151 19:969990-970012 TAAAAAAATATGTATATATAGGG - Intronic
1161463163 19:4411228-4411250 CTCAAAAATAAATAAATAAATGG - Intronic
1161695417 19:5764615-5764637 CTCAAAAATAAATAAATAAATGG - Intronic
1162889040 19:13718831-13718853 CTCAAAAATAAATAAATAAAAGG + Intergenic
1163960394 19:20684687-20684709 CTCCAATAAATGTAAATATATGG - Intronic
1165275715 19:34749433-34749455 TTCAAAAACAACTACATATACGG + Intergenic
1165429703 19:35765577-35765599 CTCAAAAATAAATAAATAAATGG + Intronic
1166017726 19:39995659-39995681 CTTAAAAATGTGTCAATATAAGG - Intronic
1166200235 19:41232677-41232699 CTCACAGATCTGTAAATATAAGG + Intronic
1167020208 19:46868688-46868710 CTGAAAAAAATGTAGATTTAAGG - Intergenic
1167202972 19:48079958-48079980 CTCAAAAATAAACAAATATATGG + Intronic
1167224132 19:48225488-48225510 CTCAAAAATAAATAAATAAAGGG + Intronic
1167869570 19:52356536-52356558 CTCAAAAATATATAAATCAATGG - Intronic
1167872109 19:52379196-52379218 CTCAAAAATATATAAATCAATGG - Intronic
1168359290 19:55725198-55725220 CTGGTAAATATGTACATATCTGG - Intronic
925567108 2:5268275-5268297 CACATACATATATACATATATGG - Intergenic
925677662 2:6382540-6382562 TTCAAAAATATATATATAGATGG + Intergenic
925841943 2:8000504-8000526 AACAAAAATAAGTACATATCTGG + Intergenic
927024852 2:19056554-19056576 CTCAAAACTATGCACATACATGG - Intergenic
927333276 2:21891131-21891153 CTCAAAAAAAGGTACATAAGGGG + Intergenic
927457173 2:23263047-23263069 CTCATATATATGTATGTATATGG - Intergenic
928813535 2:35259442-35259464 ATCAAATATATGTAGATAAAGGG + Intergenic
928831167 2:35485556-35485578 CACATAAATATATATATATATGG - Intergenic
928875101 2:36028843-36028865 ATAAAAATTATGTACATTTATGG + Intergenic
928932835 2:36642658-36642680 CTCAAAAATCTGGGCATAGAAGG + Intronic
929728649 2:44461143-44461165 CTAAAAAATTTGTAAATGTAAGG + Intronic
929731552 2:44499162-44499184 CTCAAGAATAGGCAGATATATGG + Intronic
930450905 2:51536435-51536457 CTTAAAAATAGGTACAATTAAGG + Intergenic
931081509 2:58777398-58777420 CTCAAAACTATAGACATTTAGGG + Intergenic
931270512 2:60698090-60698112 AGTAAAAATATGTACATATTTGG - Intergenic
931506890 2:62938620-62938642 CACAAAAATCTGTCCATAAAAGG - Intronic
931532038 2:63226306-63226328 CTCAAAAAAAGGAAAATATATGG - Intronic
931933867 2:67173395-67173417 CCCAAATATATGTATATATTTGG - Intergenic
931945585 2:67302869-67302891 CACATAAATATGTACATATAAGG + Intergenic
932883885 2:75529598-75529620 CTCAAAACCATGCAAATATATGG + Intronic
932894693 2:75627551-75627573 ATAAAATATATGTACATACATGG + Intergenic
932919659 2:75896654-75896676 CTCAAAAATCTGTAAATTTATGG + Intergenic
933636710 2:84716139-84716161 CCCATATATATGTATATATATGG - Intronic
934088171 2:88527491-88527513 CCAAAGAATATATACATATAAGG - Intronic
935002927 2:99038989-99039011 CTCAAAACTATAAAAATATATGG + Intronic
937561376 2:123228814-123228836 TTCAAAACCATGTACATACATGG - Intergenic
938040745 2:128074005-128074027 CCCAAAAAAATGTGCATAGAGGG + Intergenic
938230217 2:129652275-129652297 TTAAAAAATATGAACATTTAAGG - Intergenic
939132003 2:138246561-138246583 AAGAAAACTATGTACATATATGG - Intergenic
939276612 2:140005871-140005893 CCCACAAATATGTACAATTATGG + Intergenic
939790651 2:146570060-146570082 CACACATATATGCACATATATGG + Intergenic
939893541 2:147765609-147765631 TTCAAAAATGTATTCATATAAGG - Intergenic
940366040 2:152850311-152850333 CTCAAAACTATGCAAATACATGG - Intergenic
940501418 2:154498853-154498875 CTCACAAATATGAAAATAAAAGG + Intergenic
940632136 2:156253510-156253532 CACATATATATGTATATATATGG - Intergenic
941468679 2:165859032-165859054 TTTAAAAATGTGTAAATATAAGG + Intronic
941972643 2:171368868-171368890 CTTAAAAAAATATATATATATGG + Intronic
942217106 2:173732282-173732304 AAAAACAATATGTACATATATGG - Intergenic
942371880 2:175294213-175294235 CTTAAAAATATATATATATGGGG - Intergenic
942585738 2:177474668-177474690 TTAAAAAATATATACATAGATGG - Intronic
942623642 2:177875678-177875700 CTTAAAAATAAATGCATATACGG - Intronic
942666636 2:178326378-178326400 ACCAAAAATATGTATATATCTGG + Intronic
943212259 2:184982147-184982169 TTAAAAAATATGTAAATAAATGG - Intergenic
943245696 2:185448190-185448212 CTAAATAATGTGTACATATGGGG + Intergenic
943337084 2:186628962-186628984 CTCAATAATTTGTACAGATAGGG - Intronic
943511418 2:188831701-188831723 TTTAAAAATATGTAAATAAATGG + Intergenic
943922592 2:193728675-193728697 TGCATATATATGTACATATATGG + Intergenic
944381810 2:199119159-199119181 CACAAAAATCTGTATTTATAAGG - Intergenic
945270414 2:207933036-207933058 CTCAAAAATAATTGCTTATAAGG - Intronic
945748590 2:213751150-213751172 CTAAAGAAAATGTACTTATATGG + Intronic
945897094 2:215495947-215495969 ATGAAAAATATGAACATTTAAGG + Intergenic
946500852 2:220245768-220245790 CTCAAAAATAACAACAGATATGG + Intergenic
946613957 2:221489289-221489311 CTTAAATATATGTGGATATACGG + Intronic
946775369 2:223134363-223134385 ATAAAAAATATATACATGTAGGG - Intronic
947044441 2:225964634-225964656 CTCATGGATATGTACAAATATGG + Intergenic
948274303 2:236696331-236696353 ATCAACAATATGTACATGAATGG - Intergenic
949083687 2:242128331-242128353 CCCAAGAATATGTACAATTATGG - Intergenic
1168966653 20:1902709-1902731 CTCAAGAAAATGTACAATTAAGG + Intronic
1169617384 20:7464086-7464108 CTCAAAAAAATGTAGAGCTATGG + Intergenic
1169623075 20:7529712-7529734 CTCAAAACTATATAAATATATGG + Intergenic
1170099004 20:12678197-12678219 CTCAAAATCATGAGCATATAAGG - Intergenic
1170139850 20:13114594-13114616 CTCAAAATAATGTAAATTTAAGG + Intronic
1170241156 20:14167991-14168013 CACTAAAACATGTACAAATAGGG - Intronic
1170726684 20:18934752-18934774 CTCAAAACAATGCAAATATATGG - Intergenic
1171137157 20:22706076-22706098 TTCAAAATAATGTAAATATATGG - Intergenic
1171237283 20:23537338-23537360 CACAGAAATATGCATATATAAGG - Intergenic
1171242060 20:23578881-23578903 CTCAAAACTATAAAAATATATGG - Intergenic
1171515764 20:25732951-25732973 CTCATAAATATAAATATATAAGG - Intergenic
1171526282 20:25814007-25814029 CTCATAATTATGTAGACATAAGG + Intronic
1171550545 20:26041878-26041900 CTCATAATTATGTAGACATAAGG - Intergenic
1172500630 20:35424078-35424100 CTCAAAAAAAAGTAAAAATATGG + Intergenic
1173106049 20:40135022-40135044 CTCAAACATATATACTTATGTGG - Intergenic
1173568587 20:44060606-44060628 CTCAAAACAATGCAAATATATGG + Intronic
1173605044 20:44325826-44325848 CTCAAAAATAAATACATTTTTGG + Intergenic
1174599267 20:51711218-51711240 CTTAAAAATATGCACATCTCTGG - Intronic
1176280271 20:64300861-64300883 CCCAAGAATATGTACAATTATGG - Intergenic
1177053297 21:16266476-16266498 CTCAAAAATATGTAATAATAAGG + Intergenic
1177124513 21:17179680-17179702 CTCAAAAACATGCAAATACAAGG + Intergenic
1177259346 21:18709244-18709266 ATAAAAAATATGTGTATATATGG + Intergenic
1177321566 21:19528197-19528219 CTATGAAATATGTCCATATAGGG - Intergenic
1177399706 21:20587032-20587054 CACATATATATGTGCATATATGG - Intergenic
1177534900 21:22412409-22412431 CACAAATATATATACATATGAGG - Intergenic
1177934988 21:27334127-27334149 CTCAAAACTATACAAATATATGG + Intergenic
1178031416 21:28530667-28530689 CACAAAAATCTGCACATAGATGG - Intergenic
1179103082 21:38374003-38374025 CTGAAAAATATGTAAATATTGGG - Intergenic
1179371867 21:40813602-40813624 CTCAAAACTATACAAATATATGG - Intronic
1182175204 22:28278849-28278871 CACAACAACATGTTCATATATGG - Intronic
1182406928 22:30142284-30142306 CTCAAAAAAAAGTAAATATATGG + Intronic
1182685333 22:32118624-32118646 CTCAAAAATTCATAAATATATGG + Intergenic
1183800040 22:40154925-40154947 CTCTAAAATATATATATATTTGG + Intronic
1183952770 22:41360934-41360956 CTCAAAAATAAATAAATAAAAGG + Intergenic
1184377399 22:44123355-44123377 CTCAAAATTATGTACCTCAAAGG - Intronic
949359582 3:3217406-3217428 GTCAAAAATATGTATGTATCAGG - Intergenic
949622740 3:5833522-5833544 CTCAAAAAACTGTTCATAGAAGG - Intergenic
951315532 3:21185628-21185650 ATTAAAAATATATACATTTAAGG - Intergenic
951391464 3:22109309-22109331 TACAAAAATATGAACATATAAGG + Intronic
951635939 3:24777324-24777346 ACCAACAATATGTATATATAAGG - Intergenic
952370091 3:32713973-32713995 CACAAAAATTTGTACATGAATGG - Intronic
952461087 3:33526829-33526851 CTCAAAAACATGCAATTATATGG + Intronic
953191225 3:40689990-40690012 CTTGTAAATATGTACATATGAGG + Intergenic
954273102 3:49524679-49524701 CTCAAAAAAATGTATATTTAAGG + Intronic
954284372 3:49608304-49608326 TGCAAAAAAATGTACATAGATGG - Intronic
954495799 3:50959878-50959900 CTTAAAAATATACACATAGAGGG - Intronic
955540502 3:59971305-59971327 CTCAAAAATGTGAACACACATGG + Intronic
955612634 3:60774270-60774292 ATCATAAATATGTATATATAGGG - Intronic
955762957 3:62308457-62308479 CTCAAAAATATATAATTTTATGG - Intergenic
955926435 3:64010092-64010114 CTAATAAATACTTACATATAAGG + Intergenic
955953959 3:64268857-64268879 CACAAAACTGTGTTCATATATGG + Intronic
956403308 3:68902737-68902759 TACAAAAATATATACATATAAGG - Intronic
956484247 3:69704647-69704669 TATAAAAATATGTATATATAAGG - Intergenic
957153476 3:76517199-76517221 CTCACATATATGTACATACATGG - Intronic
957320321 3:78622004-78622026 GTAAAAATTATGTTCATATATGG - Intronic
957412035 3:79854456-79854478 TTACAAAATATATACATATAAGG - Intergenic
958908510 3:99967809-99967831 CTCAAAATCATGTATATAAAAGG - Intronic
959307667 3:104690202-104690224 TTCAACAATATGTACTTGTAAGG - Intergenic
959424054 3:106164103-106164125 CTGAAAAACATGTAAATACATGG + Intergenic
959523481 3:107347497-107347519 CTCAAGTATATGTAAATTTACGG - Intergenic
959543265 3:107565370-107565392 GTAAAAAATATGTACAAATAAGG - Intronic
959855061 3:111143543-111143565 CTTATAAATATGTATTTATATGG + Intronic
960094425 3:113675517-113675539 TTGGAAAATATATACATATATGG + Intronic
960151425 3:114252469-114252491 ATATGAAATATGTACATATATGG - Intergenic
960390169 3:117068036-117068058 CTCAAAAATATCTACTTATTGGG - Intronic
960477606 3:118147945-118147967 ATCAAAAATAACTACATTTACGG - Intergenic
961102861 3:124216452-124216474 CTCAGAAAAATGGACACATATGG + Intronic
961134757 3:124499892-124499914 GTGAAAAATATATAAATATAAGG - Intronic
961965947 3:130902947-130902969 CACACAACTATGTACATGTAAGG - Intronic
962019938 3:131488873-131488895 ATCAAAATTATATACATTTATGG - Intronic
962023044 3:131519813-131519835 CTCAAAAATATGTGGAAATCTGG + Intergenic
962651728 3:137500811-137500833 CTCAAAACTATATAAATACATGG - Intergenic
963087163 3:141448191-141448213 TTAAAAAATATCCACATATAAGG - Exonic
963370212 3:144389735-144389757 TTTAAAAATATGTTCATATCAGG + Intergenic
963612713 3:147492114-147492136 CTCAAAAATAAATACATGAATGG - Intronic
963918318 3:150881380-150881402 CTCAAAAATAAATAAATAGAGGG + Intronic
964243703 3:154625144-154625166 TTCAAAACTATACACATATATGG + Intergenic
964590486 3:158358113-158358135 TTTAAAAAAATGTACCTATAGGG + Intronic
964716684 3:159730093-159730115 ATGAAAACTATGTACAAATAAGG - Intronic
964811908 3:160674082-160674104 CACAAAGATATGTATGTATATGG - Intergenic
964883332 3:161448995-161449017 TTGAAAGATATCTACATATAAGG - Intergenic
964945286 3:162215626-162215648 CACACAAACATGCACATATAAGG - Intergenic
965001040 3:162953838-162953860 CTCAAATTTATGTCCATATATGG - Intergenic
965072933 3:163938903-163938925 CTTAAATATATTCACATATATGG + Intergenic
965191968 3:165542377-165542399 ATCACAAGTATGTATATATAGGG - Intergenic
965294175 3:166922689-166922711 CTGACAAATATTAACATATATGG + Intergenic
965607369 3:170510466-170510488 CTCCAAAATATTTTCATAGAGGG - Intronic
965907904 3:173732962-173732984 CACAGAAATATATACAAATATGG + Intronic
966066145 3:175824501-175824523 TTCAAAATTTTGTATATATAGGG - Intergenic
966102461 3:176288341-176288363 TTCAAGTATATCTACATATAAGG + Intergenic
966449879 3:180046205-180046227 TTCAAAAATATATTCATAAAAGG - Intergenic
966897162 3:184454142-184454164 CTCAAATATATATATATATATGG - Intronic
966981040 3:185135754-185135776 CCCATAAATATATACAAATATGG + Intronic
967229961 3:187328355-187328377 CTCAAAAAAGTGAAAATATAGGG + Intergenic
967371028 3:188746192-188746214 CTTCCTAATATGTACATATATGG + Intronic
967425985 3:189328126-189328148 CAAAAAAATATGTATATATCTGG - Intergenic
967491040 3:190090987-190091009 CTCAAAACTATGAACAAATAAGG + Intronic
967635242 3:191793017-191793039 CACAAACATATGCACATATATGG + Intergenic
968017250 3:195348784-195348806 CTCAGGAATATAGACATATAAGG + Intronic
968044123 3:195614102-195614124 ATCAAAAATATATACATCTTAGG - Intergenic
968372441 3:198234144-198234166 CCCAAGAATATGTACAATTATGG - Intergenic
969946192 4:10785586-10785608 CACAAATATATGTACTGATATGG - Intergenic
970635165 4:18001892-18001914 CTACAAATTATATACATATATGG + Intronic
970667273 4:18352260-18352282 CTCAAAAAACTGGACATAGAAGG - Intergenic
970774808 4:19660925-19660947 ATCTACAATATTTACATATATGG - Intergenic
970874758 4:20856677-20856699 CTGAAAAATATTTCCCTATAGGG - Intronic
971033605 4:22668459-22668481 CTCAAACATATGTACACTTTGGG + Intergenic
971063652 4:23002141-23002163 CTCACAAATATCTAAATATTAGG - Intergenic
971126816 4:23763491-23763513 CTCAAAAATATGACAATAAATGG + Intronic
971472037 4:27037572-27037594 CTCAAAACCATGCAAATATATGG - Intergenic
971640426 4:29124949-29124971 CTCCAAAATATGGATATTTAAGG + Intergenic
972083752 4:35186491-35186513 CTCAAAACTATGTAATTACATGG + Intergenic
972262676 4:37426098-37426120 CACACAAATATTTACAAATAAGG - Intronic
972267604 4:37477823-37477845 TTCTAAAATATGTACAGATTGGG + Intronic
973091583 4:46144072-46144094 CTCAAAACTATATAAATACATGG - Intergenic
973116961 4:46473475-46473497 CACACATATATGTATATATATGG - Intronic
973397231 4:49605657-49605679 CTCATTAATATGTATATATTCGG + Intergenic
974386696 4:61209625-61209647 CTCAGAAATAAGTACTTAAAAGG - Intronic
974400642 4:61401653-61401675 GTCAAAAATAAGTAAACATAAGG + Intronic
974466554 4:62264287-62264309 CACACATATATGTACATATATGG + Intergenic
974622247 4:64373009-64373031 CTGAAAAATCTGTAAACATATGG - Intronic
975159451 4:71109269-71109291 CTCAAAAGCAACTACATATATGG - Intergenic
975167302 4:71191351-71191373 CTGAAAACTAAGTAAATATAAGG + Intronic
975375680 4:73642000-73642022 CTCAAAAAACTGAACATAGAAGG - Intergenic
975623468 4:76317858-76317880 CTCAAAACTATATAAATACATGG + Intronic
975971457 4:80043187-80043209 CCCAAAAATTTATACAAATATGG + Intronic
976353364 4:84085366-84085388 CACAATAAAATGTTCATATAAGG - Intergenic
976360149 4:84168433-84168455 ATCAAAACTCTGTGCATATAAGG + Intergenic
977231992 4:94462550-94462572 CACATATATATATACATATATGG - Intronic
977439951 4:97052746-97052768 GTCAAAAACATGTAAAAATAAGG - Intergenic
977759418 4:100714143-100714165 CCCCAAAATATGTACAATTATGG - Intronic
977766231 4:100800864-100800886 ATCAGAAATATGCAAATATAAGG + Intronic
978859781 4:113434624-113434646 CTAAATAATATTGACATATAAGG + Intergenic
978892886 4:113851170-113851192 ATAAAAAATATGTACGTATCAGG - Intergenic
979086664 4:116419881-116419903 CTCAAATATATCTACATATTTGG - Intergenic
979261125 4:118646623-118646645 CCCAAGAATATGTACAATTATGG - Intergenic
979927544 4:126586277-126586299 CTCAATAATATGCAAATACATGG + Intergenic
979984704 4:127299252-127299274 CTCAAAACCATGTAAATACATGG + Intergenic
980242483 4:130194475-130194497 ACCAAAAATATGTATTTATATGG - Intergenic
980829094 4:138108101-138108123 CTCAGAAATATGAAAATATGTGG - Intergenic
981142756 4:141289099-141289121 GGGAAAAATATGTAAATATAAGG - Intergenic
982487115 4:155979191-155979213 TTCAAAAACATGCAAATATATGG - Intergenic
982571544 4:157056981-157057003 CTCATACACATGTACATATAGGG + Intergenic
982643830 4:157997250-157997272 TTCAAAAGGAGGTACATATATGG - Intergenic
982992030 4:162288558-162288580 CTCAAAATCATGCAAATATATGG + Intergenic
983050118 4:163036642-163036664 ATCAAAAATATGTTCCTTTAAGG + Intergenic
983064936 4:163197677-163197699 CTCTAAAATATGTAAAATTACGG - Intergenic
983122224 4:163900582-163900604 ATCAAAAATGTTTACATATTAGG - Intronic
983799945 4:171914714-171914736 TTCATAAATATGTACATTTTTGG - Intronic
984335691 4:178386848-178386870 CTCATAATCATGTACTTATATGG + Intergenic
985223603 4:187734550-187734572 CTACAAAATATGTACCTACAAGG - Intergenic
986043942 5:4019836-4019858 CTCAAAATTAAGCACAGATATGG - Intergenic
986560049 5:9051592-9051614 CTCAAAAAAATGAAAATATTTGG - Intronic
986906274 5:12497368-12497390 CACATAAATATGTACAATTACGG + Intergenic
987025112 5:13918832-13918854 CTAAAAAATAAATACAGATAGGG + Intronic
987440412 5:17949303-17949325 CTCAAAATCATGTAAATACATGG - Intergenic
987517544 5:18932759-18932781 TTCAAAAATAAGTAAATGTATGG - Intergenic
987643703 5:20644004-20644026 ATCAAAACTATGTACATGTAGGG - Intergenic
988034268 5:25805497-25805519 CTCAAAACTATGTAATTACATGG - Intergenic
988043559 5:25918349-25918371 CTCAAAACTATGTAACTATATGG + Intergenic
988109759 5:26803900-26803922 CTCACACATATGTATATACATGG - Intergenic
988126828 5:27050866-27050888 ATCTAAAATATGTAGAAATATGG - Intronic
988155489 5:27444234-27444256 CTCAAAAAAATGGGCATAGAAGG + Intergenic
988465388 5:31486064-31486086 AGGAAAAATATGTAAATATATGG + Intronic
988508428 5:31844457-31844479 CTCAGTAATACGTAAATATATGG - Intronic
988575598 5:32420658-32420680 ATCAAAAATATATGCAGATATGG - Intronic
988804069 5:34724014-34724036 CTCAAAAATAAATAAATAAAAGG - Intronic
989670164 5:43907693-43907715 ATCAATAATATGTACATGAATGG - Intergenic
990088284 5:52006583-52006605 CTCATAAATATGGACTAATATGG - Intergenic
990267017 5:54087740-54087762 CTCAAATATATATATATATTTGG - Intronic
990687620 5:58324180-58324202 CACAAACATATATACATATATGG - Intergenic
990935515 5:61144192-61144214 ATCATATATATGTACATATAAGG + Intronic
992000050 5:72427496-72427518 TTCAAAAAGATATACATAGATGG - Intergenic
992224506 5:74606969-74606991 CTCAGGAATATGTACTAATATGG - Intergenic
992689974 5:79232814-79232836 CTCAAAAATAAATAAATAAATGG - Intronic
992847564 5:80766971-80766993 CATAAAAATATATACATATATGG + Intronic
992855681 5:80859119-80859141 CTAAAATATATATATATATATGG - Intronic
992933143 5:81672237-81672259 TTCAATTATATGTGCATATAAGG - Intronic
993943600 5:94092343-94092365 CACAAGGATATGTACATAGATGG - Intronic
994304472 5:98186104-98186126 CACACACATATATACATATATGG + Intergenic
994563347 5:101407095-101407117 CTCAAAAATATACAAATACATGG + Intergenic
994636366 5:102349320-102349342 CTCAACAAAATTGACATATAAGG + Intergenic
994901267 5:105772908-105772930 CTAGCAAATATGTACATACACGG + Intergenic
995087714 5:108134249-108134271 AGCAAACATATGAACATATATGG + Intronic
995885437 5:116889064-116889086 CCCTAAAATATGTATAGATAGGG - Intergenic
995907220 5:117140067-117140089 ATTATATATATGTACATATATGG + Intergenic
996159973 5:120148906-120148928 CATAAAAATTTGTTCATATATGG + Intergenic
996237471 5:121149574-121149596 CTCAAGAACATTTTCATATACGG - Intergenic
996265750 5:121537514-121537536 CTCAAAACCATGTAATTATATGG + Intergenic
996288701 5:121826709-121826731 TTCAAAACTATGTAAATACATGG - Intergenic
996679541 5:126216523-126216545 CTGCAAAAGATGTACATATGAGG + Intergenic
996994051 5:129672827-129672849 CACACAAATACATACATATATGG + Intronic
996999566 5:129743409-129743431 CCCAAAAATATGTAAATATGTGG + Intergenic
999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG + Intronic
1000158835 5:158579524-158579546 CTCAAAACCATGTAAATATGTGG - Intergenic
1000504292 5:162094867-162094889 CTGAAAAATAGGTACATAATGGG + Intronic
1000525369 5:162351216-162351238 CTCAAAACCATGTAAATACATGG - Intergenic
1001779741 5:174357638-174357660 CTCAAAAATATGTTGATTTTAGG - Intergenic
1001869934 5:175143988-175144010 CTGAAAAATATCCACATATTAGG + Intergenic
1002127229 5:177055334-177055356 CTCAGAAAAATCTACATATTAGG - Intronic
1002731681 5:181339688-181339710 CCCAAGAATATGTACAATTATGG - Intergenic
1002752849 6:134388-134410 CCCAAGAATATGTACAATTATGG + Intergenic
1003760712 6:9175782-9175804 CAAAAAAATATATATATATATGG + Intergenic
1004201950 6:13556707-13556729 CTCTAAAATATATATCTATATGG - Intergenic
1005244332 6:23864521-23864543 CTCAAAAACATGCAAATACATGG + Intergenic
1005414890 6:25589487-25589509 CTCAAAAATAAATAAATAAAAGG - Intronic
1006925673 6:37653817-37653839 CTAATAAATATTTCCATATAGGG + Intronic
1007186174 6:39974370-39974392 CTCCAAAATATGTAGTTATGGGG - Intergenic
1007685819 6:43666773-43666795 CTCAAATATATGTATATATATGG - Intronic
1008340292 6:50356539-50356561 CTCAAAACTATGCAAATACATGG + Intergenic
1009701552 6:67189622-67189644 TTATAACATATGTACATATATGG - Intergenic
1009979613 6:70711811-70711833 ATTAAAAATATATACATATTAGG - Intronic
1010041630 6:71391506-71391528 TTCAAACATAGGTACAAATAAGG - Intergenic
1010045537 6:71438735-71438757 TTCAAAACTATGCAAATATATGG + Intergenic
1010272888 6:73934851-73934873 CTTAAAAATATGTAAATTTTAGG + Intergenic
1010408339 6:75531725-75531747 TTCCAAAATAAGTAGATATATGG + Intergenic
1010510136 6:76708329-76708351 ATAAGAAATATGTAAATATAAGG + Intergenic
1010858163 6:80869740-80869762 CTCAAAACCATGCACATACATGG - Intergenic
1010880046 6:81155916-81155938 CTCAAAACTATATAAATACATGG + Intergenic
1011038520 6:83003905-83003927 CACCAAAATGTGTACATCTAGGG - Intronic
1012658996 6:101862427-101862449 CTTAAAAATATATAAATATAAGG - Intronic
1012755083 6:103219639-103219661 TTAAAAAATATGTTTATATAAGG + Intergenic
1013072599 6:106742483-106742505 CTCAAAATTATTTTAATATATGG - Intergenic
1013256478 6:108391412-108391434 CTCAAAAGAAGGTACATAAATGG - Intronic
1013782456 6:113743862-113743884 CTAGAAAATATTTATATATAAGG - Intergenic
1014014123 6:116510281-116510303 CTCATAAATAAATACATAGAAGG - Intronic
1014382131 6:120755181-120755203 CACAAAAATATATATACATATGG + Intergenic
1014436664 6:121428089-121428111 CTCCAAAATATGTACAACTAAGG + Intergenic
1014481820 6:121948574-121948596 CTCAAAACCATGCAAATATATGG - Intergenic
1014672101 6:124317693-124317715 CTAAGAAATATGTACATTTTAGG - Intronic
1015069874 6:129079023-129079045 CTCACACACACGTACATATATGG + Intronic
1015078214 6:129189694-129189716 ATTAAAAATATGTACATTTGAGG - Intronic
1015201761 6:130590798-130590820 CACAAAAATATATATATATGTGG + Intergenic
1015483613 6:133743463-133743485 CTAACATATATGTACATATATGG - Intergenic
1015644033 6:135367067-135367089 CTCAAAACCATGTAAATACATGG - Intronic
1016484814 6:144525973-144525995 CTCAAAACCATGCAAATATATGG - Intronic
1016567108 6:145467901-145467923 CACAATAATATTTCCATATAGGG - Intergenic
1017064183 6:150513579-150513601 ATCAAAAGTATTTACATACATGG - Intergenic
1017640297 6:156487317-156487339 CTCAAAAATAAATAAATAAAAGG - Intergenic
1017988420 6:159465199-159465221 CACAATAATATATAGATATAAGG + Intergenic
1018493197 6:164318562-164318584 GTCCACAATGTGTACATATATGG - Intergenic
1019830803 7:3327561-3327583 CTGAAAAATATTTTCTTATATGG - Intronic
1020205843 7:6114988-6115010 CTTAAAAAAATATATATATAGGG - Intronic
1020237700 7:6369244-6369266 AAAAAAAATATGTATATATATGG + Intergenic
1020348812 7:7195463-7195485 CTCAAAACCATGTAAATACATGG - Intronic
1020497303 7:8872029-8872051 ATGACAAATATGTACATATTGGG - Intergenic
1020592087 7:10152447-10152469 CTCAAAACTATACAAATATATGG + Intergenic
1021283101 7:18745126-18745148 CTCAGAAACATGGACTTATAGGG - Intronic
1021369548 7:19825563-19825585 CATAAATATATATACATATATGG - Intergenic
1021789621 7:24191585-24191607 CTGATCAGTATGTACATATAAGG - Intergenic
1022564211 7:31381259-31381281 CCCAGATATATGTAAATATATGG + Intergenic
1024455986 7:49607418-49607440 CTCAAAACCATGTAAATACATGG + Intergenic
1024781788 7:52859319-52859341 TCCCAAAATATGTACAAATATGG + Intergenic
1024815652 7:53267388-53267410 CAAAAAAATATGAACATGTATGG - Intergenic
1024862371 7:53860451-53860473 CTCAAAAATCTGTATATAAGTGG - Intergenic
1024875990 7:54024138-54024160 CTCAAAAACATGCAAATACATGG - Intergenic
1025195023 7:56925901-56925923 CTCAAAAATAAATAAATAAAAGG + Intergenic
1025676929 7:63651042-63651064 CTCAAAAATAAATAAATAAAAGG - Intergenic
1025729228 7:64095466-64095488 CTAAAAAAAATGTATATATATGG - Intronic
1027026905 7:74859370-74859392 CTCAAAAATATAAATAAATAGGG - Intergenic
1027060847 7:75084740-75084762 CTCAAAAATATAAATAAATAGGG + Intergenic
1027520615 7:79201925-79201947 CTCAAAATTAGGTACAAAAATGG + Intronic
1027598968 7:80214334-80214356 CTGAAAAATATATTCAAATAAGG - Intronic
1027729304 7:81849646-81849668 CCCATAAATATGTACAATTATGG - Intergenic
1027821883 7:83057080-83057102 CAAAAAAATATATATATATATGG - Intronic
1027899135 7:84086660-84086682 CTCATATATATGTATATATATGG + Intronic
1028156264 7:87433352-87433374 CTCACAAATATTTACTTATATGG + Intronic
1028216828 7:88143231-88143253 ATCTAGAATATGTACATACAGGG - Intronic
1028300985 7:89200568-89200590 GTCAACAATATTTACATCTATGG - Intronic
1028354915 7:89895361-89895383 ATAAAAAATATGTATATATAAGG + Intergenic
1028402146 7:90435334-90435356 CTCAAAACTATGTAAATACATGG + Intronic
1028484227 7:91340657-91340679 TTCTAAAATACGTACATACATGG - Intergenic
1029673306 7:102048826-102048848 CTCAAAAATAAATAAATAAAGGG + Intronic
1029729207 7:102428452-102428474 CTGAAATATATGTTAATATATGG - Intergenic
1030565820 7:111154358-111154380 CCTAAAAATATGTATGTATATGG - Intronic
1030771796 7:113484538-113484560 CTCAAAGATTTATACACATAAGG - Intergenic
1031177014 7:118365872-118365894 CTCAAATTTATGTCTATATATGG - Intergenic
1031220134 7:118955193-118955215 CTCAAAACTATGCAAATACATGG - Intergenic
1031244156 7:119285850-119285872 CTTAAAAAGATGTAAAAATATGG + Intergenic
1031452045 7:121934001-121934023 TTAAAAAATATGTATTTATATGG + Intronic
1031517477 7:122719003-122719025 CTCAAAATTGTGTACATTTATGG - Intronic
1031523956 7:122801152-122801174 CTCAAAAATATGTACATATAGGG + Intronic
1031658520 7:124390194-124390216 CTGCAAAATATGTACAGATCGGG - Intergenic
1031925967 7:127638933-127638955 CTCAAAAATAAATAAATAAAAGG - Intergenic
1032770615 7:135051202-135051224 CTGAAAAATGTGTAAATATAAGG - Intronic
1032830317 7:135618243-135618265 ATAAAAAATATTAACATATAAGG - Intronic
1033081788 7:138305761-138305783 TTCAAAAATATATATATGTACGG + Intergenic
1034071691 7:148192126-148192148 CTTAAAAATGTGTAAATTTATGG + Intronic
1034219807 7:149435169-149435191 CTCAAAAATATGTACATATATGG - Intronic
1034598435 7:152222692-152222714 TTAAAAAAAATGTACAAATATGG - Intronic
1035511834 8:194570-194592 CCCAAGAATATGTACAATTATGG + Intronic
1035874102 8:3168648-3168670 CACACAAATATATATATATATGG + Intronic
1036083330 8:5583018-5583040 CTAATAAATATGTACAAAGATGG + Intergenic
1037340714 8:17841447-17841469 CTGGAAAATATGTAAATATATGG + Intergenic
1037677214 8:21061527-21061549 CTCAAAAATATTTACAGGCATGG + Intergenic
1037692278 8:21192000-21192022 CTTACAAATATGTATTTATATGG - Intergenic
1038093319 8:24279130-24279152 ACCAAATATATGGACATATATGG + Intergenic
1038544570 8:28415278-28415300 CAGAAAAACAAGTACATATAGGG - Intronic
1039058870 8:33557818-33557840 CTCAAAAATAAGAGCTTATAAGG + Intronic
1039269439 8:35864670-35864692 TGCATATATATGTACATATATGG + Intergenic
1039605810 8:38879525-38879547 CCCATATATATGTATATATATGG - Intergenic
1039629402 8:39092531-39092553 ATAAGAAATATATACATATATGG - Intronic
1040529089 8:48251096-48251118 ATCAAAACTATGCAAATATATGG - Intergenic
1040820376 8:51549532-51549554 CTCAAAAATATACAAATACATGG + Intronic
1040847806 8:51862870-51862892 CTCAAAAATATATAAGTACAAGG + Intronic
1040863616 8:52025402-52025424 CTCAATATTTTGGACATATAAGG - Intergenic
1041170076 8:55132400-55132422 ATCATAGGTATGTACATATAGGG - Intronic
1041449330 8:57990712-57990734 ATCAATATTATGTACATTTAGGG + Intergenic
1041480346 8:58313122-58313144 TTCAAAATTGAGTACATATATGG + Intergenic
1042883343 8:73519606-73519628 CACAAAAAAATGTCCTTATAGGG + Intronic
1043193784 8:77263877-77263899 CTCAAATATATATAAATATATGG + Intergenic
1043301369 8:78738151-78738173 CTTGTAAATGTGTACATATATGG + Intronic
1043330519 8:79111790-79111812 TTTAAAAATATGTATATATTAGG - Intergenic
1043951582 8:86315418-86315440 CTCAAAACTATGTAATTACATGG + Intronic
1044487909 8:92774113-92774135 AGCAATAATATATACATATATGG + Intergenic
1045010093 8:97951336-97951358 ATGAAAAAAATGTACATATCAGG + Intronic
1045512843 8:102826922-102826944 ATTAAAAATATATATATATAGGG - Exonic
1045882361 8:107056473-107056495 ATAAAGAATATGTTCATATATGG - Intergenic
1045952168 8:107864882-107864904 CTCAAAACTATACAAATATATGG - Intergenic
1046111016 8:109724774-109724796 CTCAAAACTATGCAAATACATGG + Intergenic
1046152899 8:110251968-110251990 ATGAAAATTATGTAAATATAAGG + Intergenic
1046217514 8:111168241-111168263 CTTAAAAATAGTAACATATATGG + Intergenic
1046230781 8:111353805-111353827 CTCAAAAATATGTTTAAAGATGG + Intergenic
1046261117 8:111769062-111769084 CTGAAAAATATATCCAAATAAGG + Intergenic
1046266981 8:111843475-111843497 TTTAAAAATATGTATGTATATGG + Intergenic
1046343800 8:112895368-112895390 CCCAGAAATATTTACATATCAGG - Intronic
1047267264 8:123317560-123317582 CTCTACAATGTGTACATTTAGGG + Intergenic
1049938881 9:525661-525683 CTCAAAAATATGAAATTCTACGG - Intronic
1050121256 9:2310190-2310212 CTCAAAAAACTGTATATAGAAGG - Intergenic
1050620173 9:7443953-7443975 CTCTAAAATATGAATATATTTGG - Intergenic
1050960655 9:11725914-11725936 ATAAAAAATATATATATATATGG - Intergenic
1050962799 9:11758015-11758037 TTCAAAAATATTGTCATATATGG - Intergenic
1051113657 9:13669378-13669400 CCCATAAATCTGTGCATATATGG + Intergenic
1051460504 9:17307892-17307914 CTCAAAATTATATACAGCTACGG - Intronic
1051828470 9:21248644-21248666 CTCAAAAATAGATATAGATATGG + Intergenic
1051937724 9:22464769-22464791 ATAAAACATATGTACATAAATGG - Intergenic
1052345300 9:27403394-27403416 ACCACAAATATGCACATATAGGG + Intronic
1052422218 9:28257889-28257911 CTCCAATATAAGTACATAAAAGG - Intronic
1052564812 9:30135863-30135885 CTCAAAACCATGTAAATACATGG + Intergenic
1052620542 9:30903180-30903202 CTCAAAAATTTGTACACCAAAGG - Intergenic
1052726967 9:32240589-32240611 AAAAAAATTATGTACATATATGG - Intergenic
1053261546 9:36670198-36670220 CTCAATAATGTGTATATATGTGG + Intronic
1053261765 9:36672392-36672414 CTCAATAATGTGTATATATGTGG - Intronic
1055198254 9:73623929-73623951 CACAAAATTATGTGCATATATGG + Intergenic
1055783888 9:79851022-79851044 CTGAAAAAAATGTACAAAGATGG + Intergenic
1055959545 9:81807437-81807459 CTCAAAAATAAATAAATAAATGG + Intergenic
1056582409 9:87901282-87901304 CTCAAAACCATGCAAATATATGG + Intergenic
1056671832 9:88636329-88636351 CTCAAAACTATGCAAATACATGG - Intergenic
1057570674 9:96202059-96202081 CTCAAAAATCTGTACCTCGAAGG - Intergenic
1057628967 9:96703870-96703892 ATCCTAAATATGTAGATATATGG + Intergenic
1057714256 9:97477768-97477790 CTCCAAAATATTAAAATATAAGG - Intronic
1057825118 9:98367112-98367134 TTCAAAAATGTGGACATATAGGG + Intronic
1057959817 9:99444302-99444324 CCAAAAAATATATATATATATGG - Intergenic
1058062923 9:100517411-100517433 ACCAAAAATATGTACAAGTAAGG - Intronic
1058249679 9:102676010-102676032 ATCAAAAAACTGTACATATTTGG - Intergenic
1058690039 9:107512246-107512268 CTCAAAAATAAATAAATAAAAGG + Intergenic
1059095180 9:111405746-111405768 CTCAAAAAAAGGTATATAAATGG + Intronic
1059143335 9:111874999-111875021 CTCAAAAATAAATAAATAAATGG - Intergenic
1059294170 9:113254896-113254918 CTCAAAAATAAATAAATAAAAGG + Intronic
1060056281 9:120416448-120416470 CTTAAAAATTTGTACAGACAAGG + Intronic
1060711822 9:125873299-125873321 GACAAAAATCTGTAAATATACGG + Intronic
1062311355 9:135939242-135939264 CCATAAAATATGTACATATAAGG + Intronic
1062756087 9:138292198-138292220 CCCAAGAATATGTACAATTATGG - Intergenic
1203704100 Un_KI270742v1:21661-21683 CTCATAGATATGTATGTATAGGG - Intergenic
1203559902 Un_KI270744v1:44160-44182 CTCATAGATATGTATGTATAGGG + Intergenic
1185700138 X:2224687-2224709 CACAAATATATATACACATATGG + Intronic
1185879898 X:3731677-3731699 CTCAAAAATAAATAAATAAAAGG + Intergenic
1186247975 X:7634504-7634526 CTCAAAACTATGCAAATACATGG + Intergenic
1186769980 X:12808160-12808182 ATCAAAAATAGGTATATATGGGG - Intronic
1186821565 X:13293218-13293240 CTCATATATATATACACATATGG - Intergenic
1187242790 X:17528792-17528814 CTCAAATATTTATAAATATATGG + Intronic
1187486656 X:19710663-19710685 CTCATAGATATGTACGTATAGGG + Intronic
1187656621 X:21482453-21482475 CTCAAAATTCTGTGAATATAAGG + Intronic
1187749457 X:22445913-22445935 CTGAAAATTATGTACTTTTAAGG - Intergenic
1187795667 X:23001027-23001049 CTCAAAAGCATTTGCATATATGG + Exonic
1188242238 X:27807519-27807541 CACAAAATTGTGTACATCTATGG + Intergenic
1188656066 X:32696989-32697011 CTAAAAAATGTGTACATTTTTGG - Intronic
1188664258 X:32799805-32799827 TGCAAAAATAAGTACATCTAGGG - Intronic
1188900421 X:35725879-35725901 ATCAAAAATCTGTACACATGTGG + Intergenic
1189126265 X:38450318-38450340 TTCATAAATATGTACATATCTGG + Intronic
1189151763 X:38716166-38716188 TTTAAAAATATTTACATATATGG - Intergenic
1189373859 X:40451027-40451049 CCCCAAAATATGTACAACTATGG - Intergenic
1189945772 X:46176853-46176875 CTCAAAAACATGCAAATACATGG - Intergenic
1190715985 X:53104038-53104060 CTCAAAAATAAATAAATAAAAGG - Intergenic
1191654392 X:63580279-63580301 CTGCAAATTATTTACATATATGG - Intergenic
1191744476 X:64470959-64470981 GACAAAAATATGTATATTTATGG + Intergenic
1192031639 X:67519848-67519870 TTCAAAACTATGCACATACATGG + Intergenic
1192400974 X:70835788-70835810 TTCAAAAATGTGTACATTTGGGG + Intronic
1192682928 X:73271202-73271224 CTCAAAATTATACAAATATATGG + Intergenic
1192978557 X:76314282-76314304 TTCAAAAACATGTAAATACATGG - Intergenic
1193270688 X:79526890-79526912 CTCAAAACTATACAAATATATGG + Intergenic
1193561339 X:83021569-83021591 CTAAAAATTATTTACATATTTGG - Intergenic
1193587077 X:83337289-83337311 TACAAAAATAAGTACATAAAAGG + Intergenic
1193682210 X:84536030-84536052 CTCATAAATCTGTACAGTTATGG + Intergenic
1193750316 X:85334407-85334429 CTGAAGAATATAAACATATACGG + Intronic
1193806401 X:86001097-86001119 CCCAAAAATATATACAACTATGG + Intronic
1194014497 X:88602774-88602796 CTCAAAATTATGCAAATACATGG - Intergenic
1194040221 X:88931959-88931981 ATCAAAAATATCACCATATATGG - Intergenic
1194156700 X:90399000-90399022 TTCAAAATTATGTACACATAAGG - Intergenic
1194438860 X:93904266-93904288 CTCAAAACTATGCAAATACATGG - Intergenic
1194596584 X:95866826-95866848 CTCAAAACTATGCAAATACATGG + Intergenic
1194960760 X:100232734-100232756 GTCAAAAATATTTACTTAGAAGG - Intergenic
1195015840 X:100779903-100779925 TTCAAAATGATGTACATACATGG - Intergenic
1195838515 X:109146501-109146523 CTCAAAACTATGCAAATACATGG + Intergenic
1196006842 X:110845601-110845623 GTCAAAGATATGTAGATATATGG + Intergenic
1196550688 X:117020550-117020572 CTCAAAACTATGTGAAGATATGG + Intergenic
1197437401 X:126448492-126448514 CCCAAAAATATGGAGATGTATGG - Intergenic
1197463639 X:126774036-126774058 CTCAAAACTATGTAACTACATGG + Intergenic
1197536881 X:127701040-127701062 CTCAAAAAAATCTATATAAAAGG + Intergenic
1197545498 X:127818732-127818754 CTCAAAATCATGCAAATATATGG + Intergenic
1198588731 X:138151921-138151943 CACACATATATATACATATATGG + Intergenic
1198665288 X:139015035-139015057 CTCAAAAAACTGGACATAGAAGG + Intronic
1199909153 X:152267183-152267205 CTCAACAAAATGGACATAGAAGG - Intronic
1200328947 X:155273936-155273958 CTCAAAAAAATATATACATATGG + Intergenic
1200503048 Y:3975985-3976007 TTCAAAATTATGTACACATAAGG - Intergenic
1200783889 Y:7241639-7241661 CTCAAAAATAAATAAATAAATGG + Intergenic
1200978272 Y:9236851-9236873 CTCAAAAATGTATACAGAAATGG + Intergenic
1201392203 Y:13510896-13510918 CTCAAAAAAAAATATATATATGG + Intergenic
1201641633 Y:16184486-16184508 CACACAAATATGTGTATATATGG - Intergenic
1201661182 Y:16400836-16400858 CACACAAATATGTGTATATATGG + Intergenic
1201931841 Y:19359161-19359183 TTTAAAAAAATATACATATAGGG - Intergenic
1202382595 Y:24289052-24289074 CCCAAGAATATGTACAATTATGG - Intergenic
1202488189 Y:25381072-25381094 CCCAAGAATATGTACAATTATGG + Intergenic