ID: 1034219919

View in Genome Browser
Species Human (GRCh38)
Location 7:149436274-149436296
Sequence GAGGTTAAATAGATGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034219919_1034219928 -1 Left 1034219919 7:149436274-149436296 CCTTGCCCCATCTATTTAACCTC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1034219928 7:149436296-149436318 CTGTCTGTAAAATGAGGGGTGGG No data
1034219919_1034219929 4 Left 1034219919 7:149436274-149436296 CCTTGCCCCATCTATTTAACCTC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1034219929 7:149436301-149436323 TGTAAAATGAGGGGTGGGATAGG 0: 1
1: 1
2: 5
3: 33
4: 331
1034219919_1034219923 -7 Left 1034219919 7:149436274-149436296 CCTTGCCCCATCTATTTAACCTC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1034219923 7:149436290-149436312 TAACCTCTGTCTGTAAAATGAGG No data
1034219919_1034219925 -5 Left 1034219919 7:149436274-149436296 CCTTGCCCCATCTATTTAACCTC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1034219925 7:149436292-149436314 ACCTCTGTCTGTAAAATGAGGGG 0: 1
1: 0
2: 4
3: 38
4: 226
1034219919_1034219927 -2 Left 1034219919 7:149436274-149436296 CCTTGCCCCATCTATTTAACCTC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1034219927 7:149436295-149436317 TCTGTCTGTAAAATGAGGGGTGG 0: 1
1: 0
2: 2
3: 30
4: 257
1034219919_1034219924 -6 Left 1034219919 7:149436274-149436296 CCTTGCCCCATCTATTTAACCTC 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1034219924 7:149436291-149436313 AACCTCTGTCTGTAAAATGAGGG 0: 1
1: 0
2: 6
3: 40
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034219919 Original CRISPR GAGGTTAAATAGATGGGGCA AGG (reversed) Intronic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
901071997 1:6525296-6525318 AAGGTTTAATAGATAGGGCTGGG - Exonic
902047407 1:13536061-13536083 GAAGGGAAATAGGTGGGGCATGG + Intergenic
903638644 1:24839682-24839704 GAGCTCAATTAGGTGGGGCAGGG - Intronic
904497912 1:30897753-30897775 GAGGTTAAATAATTTGTGCAAGG - Intronic
905514091 1:38548802-38548824 GAGGTTAAATAGCTTGCTCAAGG - Intergenic
906887511 1:49666827-49666849 GAGGTTAAATAATTGGCTCAAGG + Intronic
910277142 1:85461958-85461980 GAGATTAAATAAATTGGCCAGGG - Intronic
913708018 1:121447772-121447794 GAGGTTAAATAATTTGTGCAAGG + Intergenic
915450832 1:156003796-156003818 GAGGCTAAATAGGTGGCACAAGG - Intronic
915484711 1:156212215-156212237 GAGCTTAAAGAGATGGGGTGAGG - Exonic
915537298 1:156544576-156544598 GCAGTTAAATAGAGGGGGAAGGG + Intronic
915798959 1:158768103-158768125 GACATTAAAAGGATGGGGCATGG - Intergenic
917529077 1:175817101-175817123 GAAGTCACAAAGATGGGGCATGG - Intergenic
919915926 1:202139272-202139294 CAGGCTAAAGAGATGGGGCTCGG + Intronic
922429099 1:225529400-225529422 GAGTTTAAATAGAGTGGTCAGGG - Intronic
1063862186 10:10323076-10323098 AAGGTTAAGTAGATGGTGGATGG + Intergenic
1064353586 10:14598894-14598916 GAGGTCAAAGAGCTGGGGCCTGG + Intronic
1064881670 10:20062133-20062155 AAGGTTAAATAGGCTGGGCACGG + Intronic
1066084227 10:31961075-31961097 GAGGGCAAATAAATGGGGCCAGG - Intergenic
1067791614 10:49292617-49292639 GAGGTTGAATAAATGGTTCAAGG - Intergenic
1069201191 10:65618745-65618767 GAGGTGAATTTGGTGGGGCAGGG + Intergenic
1069799988 10:71076065-71076087 GGGGTTAAATCTCTGGGGCAAGG + Intergenic
1071105552 10:82089951-82089973 GAGGGCAAAGAGCTGGGGCAGGG - Intronic
1072389981 10:94973545-94973567 GAGGATCACTAGATGGGGGAGGG - Intronic
1072538130 10:96378647-96378669 GAGGTTAAATAGCTTGCCCAAGG + Intronic
1073797733 10:107006377-107006399 GAGAATAAATAGATGGCACAGGG + Intronic
1075811119 10:125225634-125225656 GAAGTCAAATAGATGAGGCTGGG - Intergenic
1077024570 11:433523-433545 GAGGTGGAATAGAGGGGGGAGGG - Intronic
1078096209 11:8298815-8298837 AAGTTCAAATGGATGGGGCAAGG + Intergenic
1078370011 11:10736584-10736606 GAGGTTAGCCAGAGGGGGCAGGG + Intergenic
1081803168 11:45873564-45873586 GAGGTTAAATGTCTGGGTCAAGG + Intronic
1084857237 11:71997044-71997066 GAGGTCATATAGTTGGGCCATGG + Exonic
1085430241 11:76441832-76441854 GAGGTTAAATAGCTGGCCCAAGG - Intergenic
1085633993 11:78143893-78143915 GAGGTTAAATAGACAGGACCTGG - Intergenic
1086594123 11:88550935-88550957 GAGGTTAAATAAATTGCCCAAGG - Intronic
1086725351 11:90175888-90175910 AAAGTTAAATAGATGGGACAAGG - Intronic
1087451011 11:98324639-98324661 CAAGTTAAAGAGATGTGGCAAGG - Intergenic
1087794071 11:102437274-102437296 AGGGTTAAAGAGATGGGGCTGGG - Intronic
1088179017 11:107088181-107088203 GAGTTCAAAGAGATGGGGAAAGG - Intergenic
1089787656 11:120919773-120919795 GAGGTAAAAGGGATGGGGCCTGG + Intronic
1090984545 11:131754327-131754349 AAAGTTAAATACATGGGGCTGGG + Intronic
1091094214 11:132803525-132803547 GAGGTAAAATTGATGGGACATGG + Intronic
1091280281 11:134377891-134377913 GAGGATAAATGGAGAGGGCAAGG - Intronic
1091639667 12:2226363-2226385 GAGGTTAAATAACTTGGCCAAGG + Intronic
1092550912 12:9498813-9498835 GAGGTTAAATACATTGCTCAAGG + Intergenic
1092880057 12:12881184-12881206 GAGGTTAAATAGTTGGCCCCAGG + Intergenic
1094159731 12:27377884-27377906 GAGGGTGAATGGTTGGGGCAGGG + Intronic
1096402084 12:51315649-51315671 GAGGTTAGAGAGGTTGGGCAGGG + Intronic
1097358313 12:58627687-58627709 GAGGATAAATATATTGGCCAAGG - Intronic
1097888299 12:64752098-64752120 GAGGTTAAATAGTTTGTCCAAGG + Intronic
1098210206 12:68155809-68155831 GAGGTTAAGTAGCTGGCTCAAGG - Intronic
1099411526 12:82334802-82334824 GAGGTGAAATGGATGGGACTTGG - Intronic
1100406206 12:94274795-94274817 GAGGTTAAATAAATGGCACAAGG - Intronic
1100444223 12:94646248-94646270 TAGGTTAGAGAGATGGGGGAGGG + Intronic
1102107394 12:110337121-110337143 GATGTGAAAAAGATGGGACAAGG - Intronic
1102250756 12:111385792-111385814 GAGGTTGATTAGGTCGGGCATGG + Intergenic
1103606180 12:122087624-122087646 GAGGTAAGATAGAAGAGGCAAGG + Intronic
1104193351 12:126505362-126505384 TAGATTAAATAGATGGAGGATGG + Intergenic
1106496098 13:30277379-30277401 GAGGTTAAATAGCTTGCTCAAGG + Intronic
1107596472 13:41968050-41968072 GAGGATAAATACATGGATCAAGG - Intergenic
1108521195 13:51248378-51248400 GTGGGTAAATAGAAGAGGCATGG - Intronic
1108638044 13:52355711-52355733 GAGGTTAAATAGCTGGTCCAAGG - Intergenic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1112104158 13:96222447-96222469 GAGGCAAAATAGCTGGTGCAAGG + Intronic
1113454697 13:110439885-110439907 GAGGTTAAATAAATAGGCCTTGG + Intronic
1114747052 14:25160345-25160367 GTGGTTAAATATTTGGGGCGTGG + Intergenic
1115284138 14:31699490-31699512 GAGGTTAAATAACTTGGGCAGGG + Intronic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1117538437 14:56723786-56723808 GGGGATAAAGGGATGGGGCAGGG + Intronic
1119567621 14:75641957-75641979 GTGGCAACATAGATGGGGCAGGG + Intronic
1120038279 14:79723367-79723389 AAGGTTAAATAGCTGGGCCATGG - Intronic
1120067008 14:80054146-80054168 GAGATTAAATAAATTGGTCAGGG + Intergenic
1120110447 14:80548173-80548195 GAGGTTAAATAATTTGGCCAGGG + Intronic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1123190151 14:106561745-106561767 GAGGTGAAAGGCATGGGGCAGGG - Intergenic
1129157630 15:73728663-73728685 GAGGTGAAATAGCTGGTGCAAGG + Intergenic
1129219978 15:74126686-74126708 GAGGTTAAATAGCTTGGCTAAGG + Exonic
1130046123 15:80446374-80446396 GAGGTTCAATAGCTTGCGCACGG + Intronic
1130199844 15:81814773-81814795 TAGGTGAAAGAGATGGGTCAGGG + Intergenic
1130552907 15:84903325-84903347 GAGGTTAAATAACTGGCCCAAGG - Intronic
1130983306 15:88827844-88827866 GAGGTTAAATAATTGAGCCAAGG + Intronic
1131016834 15:89064924-89064946 GAGGGCAATGAGATGGGGCAGGG - Intergenic
1131197119 15:90364502-90364524 GAGGTAAAATTAATGGGGCTTGG - Intronic
1134401971 16:13918601-13918623 GAGGTTATATAACTTGGGCAAGG - Intergenic
1135712370 16:24729195-24729217 GAGGTTAAATAACTGGCCCAAGG + Intergenic
1135867233 16:26114847-26114869 GAGGTTGAATTGCTGGGTCATGG - Intronic
1136634956 16:31514886-31514908 GAGGTTCAAGAGATCAGGCAGGG - Intergenic
1137871317 16:51953228-51953250 GAGGTTAAATAAATTGCCCAAGG - Intergenic
1138512052 16:57514600-57514622 GAGGTTAAATAAATGTCCCAAGG + Intronic
1139352583 16:66346574-66346596 GAGGAGAGATAGGTGGGGCAGGG + Intergenic
1139505367 16:67395770-67395792 GAGGCTGAATAGATGAGGTAAGG - Intronic
1140873490 16:79128491-79128513 GAGGTTAAATAACTTGGCCAAGG + Intronic
1141201814 16:81904057-81904079 GAGGTTAAATAGCTCAGCCAGGG + Intronic
1141441880 16:84034419-84034441 GAGGTAAGACAGATGGGGGAGGG + Intronic
1143480172 17:7223619-7223641 GAGGTTGCATAGTTGGGACATGG - Intronic
1144224742 17:13134024-13134046 AAGGTTAAATAGATGCTGGATGG - Intergenic
1144300337 17:13917515-13917537 GAGGTTCAAATGATGAGGCAAGG + Intergenic
1145282890 17:21480653-21480675 GAGGTGAAGAAGATGGGGCTGGG - Intergenic
1148020851 17:44552511-44552533 GGGGTGAAATAGATGGAGTAGGG - Intergenic
1149454562 17:56777403-56777425 GAGCTTGCAGAGATGGGGCAGGG - Intergenic
1155980104 18:32171083-32171105 AAAGTTAAATAGATGGGTCTTGG + Intronic
1155991199 18:32281136-32281158 GAGGTTAAATATTTTGTGCAAGG + Intronic
1156472213 18:37384406-37384428 GAGGACACATAGGTGGGGCAGGG + Intronic
1157139086 18:45087617-45087639 GAGGATGAATGGATGGGGCTGGG + Intergenic
1157814115 18:50718789-50718811 AAGGTAAAATAGGTTGGGCATGG + Intronic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1158453601 18:57587641-57587663 AAGGTAAAAGAGATGGGGTAGGG + Intergenic
1158815906 18:61096534-61096556 GATGTTAAATTGTTGGGGAAAGG - Intergenic
1159919725 18:74216525-74216547 GAGGTTGGAGAGATGGGGAAGGG - Intergenic
1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG + Intronic
1160809758 19:1008280-1008302 GCGGTTACAGAGGTGGGGCAGGG + Exonic
1161432604 19:4242107-4242129 GAGTTTATATAGCTGGGGAATGG + Intergenic
1163092929 19:15033785-15033807 GAGTTTAAATAGTTTGGCCAAGG - Intergenic
1165378158 19:35458605-35458627 GATGATAGATAGATGGGGGAAGG + Intergenic
1166631617 19:44412059-44412081 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1166636559 19:44456562-44456584 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1167418035 19:49387127-49387149 GATATTAAAAAGATTGGGCATGG + Intergenic
1167427315 19:49436180-49436202 GAGATTAAATAGATGTGACCCGG + Intronic
1168243301 19:55097837-55097859 GGGGTTTAATAGGTGGGGCAGGG - Intronic
926869277 2:17394681-17394703 GAGGTTTACTTGATGGGGCAGGG + Intergenic
927304639 2:21556435-21556457 GAGGTTAAATAAATAAGACATGG + Intergenic
927934051 2:27065302-27065324 GATGGTAAATGGATGGGGTAGGG - Intronic
928987738 2:37197211-37197233 GAGGTTTACTAGCTGCGGCAAGG - Intronic
929950347 2:46405411-46405433 GAGGTTAAGGAGCTGGGTCAAGG + Intergenic
930600842 2:53441054-53441076 AAGGTTAAATAAATTGGCCAAGG - Intergenic
930726388 2:54685989-54686011 AAAGTTAACTAGATGGGGCTGGG - Intergenic
930881467 2:56275479-56275501 GATGTTAAATAGCTGGTGTAAGG - Intronic
931775248 2:65534835-65534857 TAGGTTAAATGGATGGCCCAAGG + Intergenic
932585808 2:73027955-73027977 AAGATTAAAAAGATGGGGCCAGG - Intronic
933742841 2:85548227-85548249 GAGGTAAAATTGATGGGACTTGG + Exonic
935603697 2:104948259-104948281 GACATAAAAGAGATGGGGCAGGG + Intergenic
937260702 2:120585346-120585368 GAGGCTAGAAAGATGGGGGAGGG + Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
938541390 2:132286616-132286638 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
940294061 2:152104283-152104305 CAGGTTGAATAGGTGGAGCATGG + Intergenic
942006769 2:171710010-171710032 AAGGTTAAAAAGATGTGGCTGGG - Intronic
942057827 2:172201247-172201269 GCTGTTAAATAAATGGGGGAAGG + Intergenic
942877629 2:180820593-180820615 GAGGTTAAATAAATTGTTCAAGG - Intergenic
944345366 2:198659097-198659119 GAGTTGAAATATATGGGGAAAGG - Intergenic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
948150119 2:235738237-235738259 GGGGTGAGATAAATGGGGCAGGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
1168732034 20:92789-92811 TTGTTTAAATAAATGGGGCATGG - Intronic
1169961579 20:11166011-11166033 GAGGTTAAATAATTGGCCCAAGG - Intergenic
1170201848 20:13752752-13752774 GAGATAAAATAAATGTGGCAGGG + Intronic
1171870291 20:30519638-30519660 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1172124044 20:32614571-32614593 GAGGTAAAATAGATGGGCTCTGG - Intergenic
1172204100 20:33150030-33150052 GAGGTTATATAAATTGGACAAGG + Intergenic
1172953946 20:38742088-38742110 CAGGTTAAGTAGATGGAGCAGGG - Intergenic
1173009700 20:39170583-39170605 AAGGCTAACTGGATGGGGCAGGG + Intergenic
1173430186 20:42980972-42980994 GAGGTTAAAAAGTTGGAGAAAGG - Intronic
1174983092 20:55419638-55419660 GAGGTTAAAGAGTTGGGGGTGGG - Intergenic
1175627445 20:60500918-60500940 GAGGTTATGCAGATGGGGAAAGG + Intergenic
1176603224 21:8811103-8811125 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1176612092 21:8992473-8992495 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1180345510 22:11702660-11702682 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1180352208 22:11814652-11814674 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1180353275 22:11820901-11820923 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
1180384964 22:12171456-12171478 GAGGTGAAAGAAATGGGGAAGGG + Intergenic
1180819669 22:18817416-18817438 GTGGTTGAATAGATGTGTCACGG - Intergenic
1181205893 22:21251861-21251883 GTGGTTGAATAGATGTGTCACGG - Intergenic
1183327457 22:37202222-37202244 GAGGTGAAATAAATGGCCCAAGG + Intergenic
1203221027 22_KI270731v1_random:43552-43574 GTGGTTGAATAGATGTGTCACGG + Intergenic
1203269798 22_KI270734v1_random:43269-43291 GTGGTTGAATAGATGTGTCACGG - Intergenic
953081381 3:39622154-39622176 GAAGGTAAATATATGGGGGAGGG + Intergenic
955760175 3:62271574-62271596 CATGTGAAATAGATGGGGCAGGG + Intronic
955922278 3:63969987-63970009 GAGGTCAAATAAATCGGCCAGGG + Intronic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
957902852 3:86519197-86519219 GAGGTTCAATAAATTGGGCCAGG - Intergenic
958036782 3:88179415-88179437 GAGATTTAATGGATGGGGGATGG + Intergenic
959096835 3:101965604-101965626 GAGGTTAAATAGATTGCTCAAGG + Intergenic
959110359 3:102115643-102115665 CAGGATAAATGGATGAGGCAGGG - Intronic
959333111 3:105031580-105031602 AAGGTTAAATGGACCGGGCATGG + Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
960363514 3:116743206-116743228 TTGGTTAAATACATGTGGCAAGG - Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962348637 3:134640875-134640897 GAGAATAAACAGAGGGGGCAAGG - Intronic
962898051 3:139733738-139733760 GTGGTGAAATGGCTGGGGCATGG + Intergenic
962989338 3:140564251-140564273 GAGCTGGACTAGATGGGGCAGGG - Intronic
963909070 3:150799753-150799775 GTGGTTAAATAGAGGTGGCTGGG - Intergenic
965993200 3:174845635-174845657 GAGCTTATTTTGATGGGGCAAGG + Intronic
967904549 3:194489113-194489135 GAGGTGAAATAGATAGGACTTGG - Intronic
969696869 4:8739989-8740011 GAGCTGAAATTAATGGGGCATGG + Intergenic
970635876 4:18009370-18009392 GAGATTATATACATGGGGTAGGG - Intronic
971132003 4:23821783-23821805 GAGGTTAAGTAAATGGACCAAGG + Intronic
971834213 4:31741195-31741217 GAGGTTAAATAGATTTTTCAAGG - Intergenic
973107423 4:46357491-46357513 GAAGTTAAATAAATTGGCCAAGG - Intronic
973176167 4:47208324-47208346 GAGGCTGAAGAGATGGGGAATGG + Intronic
973376657 4:49291589-49291611 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
973377576 4:49297741-49297763 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
973378495 4:49303877-49303899 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
973380567 4:49317626-49317648 GAGGTGAAAGAAATGGGGGAGGG - Intergenic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
978978157 4:114906614-114906636 GAGGTAAAAAAGATGGTTCATGG - Intronic
981547297 4:145907062-145907084 GAGGTTAAATAAATGGTGAGAGG + Intronic
986865536 5:11982054-11982076 GAGGTTATATATATAGGCCAGGG + Intergenic
987589179 5:19901001-19901023 GAAGTTAAATAGATTTCGCAGGG - Intronic
988391321 5:30636563-30636585 TATGTTAAATAGATGTGGCAAGG + Intergenic
989970081 5:50512928-50512950 GAGGTTAAATAATTAGTGCAAGG - Intergenic
990409446 5:55526635-55526657 GAAGTTAAATAGAAGAGGCCAGG + Intronic
991661209 5:68952450-68952472 GAGGTTAAAAAGATCAGCCATGG - Intergenic
994734561 5:103536393-103536415 CAGGTTAAAGAGAAGGGTCAAGG - Intergenic
996332049 5:122341042-122341064 GGGGTTGAATAGAAGGGGAAGGG - Intronic
996704886 5:126487257-126487279 GTAGTTTAATAAATGGGGCAAGG - Intronic
997166586 5:131666586-131666608 TAAGTTACATAGATGGGGAATGG - Intronic
997410497 5:133687202-133687224 GAGGCTAAATAGGGGGGGCATGG + Intergenic
998404525 5:141866642-141866664 GAGGTTAAATAATTGGCCCAAGG - Intronic
998522632 5:142814739-142814761 GAGGTTAAATAATTGGCTCAAGG - Intronic
999365522 5:151021045-151021067 GAGGTGACATAGATGTAGCAAGG - Intronic
999897453 5:156050785-156050807 GAGGATAAATAAATGGGCCAAGG - Intronic
999961166 5:156757136-156757158 GAGGTTAAAAAAATGGGTCTAGG - Intronic
1000948763 5:167454636-167454658 GATGGGAAAGAGATGGGGCAGGG - Intronic
1002482708 5:179513896-179513918 GAGAGTAAAAAGATGGGGCCGGG - Intergenic
1002556239 5:180043526-180043548 GAGGTAAAAAAGATGAGGCTTGG - Intronic
1003350326 6:5311286-5311308 TAGATTAAATAGATGCTGCAGGG + Intronic
1003615877 6:7654882-7654904 CAGGTAAAATAAATGGGGTAGGG + Intergenic
1004147996 6:13088058-13088080 TATGTTAAATAGAGGGGGTAAGG - Intronic
1006596563 6:35197128-35197150 CAAGTTAAAAAGATGGGGAAGGG - Intergenic
1006732121 6:36244010-36244032 GAGGTTGAGTAGCTTGGGCAAGG + Intronic
1007843921 6:44738634-44738656 CAGGGTAAAAAGATGGGGCCTGG + Intergenic
1007872645 6:45058727-45058749 GAGCTAAAAATGATGGGGCAGGG - Intronic
1008036487 6:46750440-46750462 GATATTAAAGAGATTGGGCAGGG - Intronic
1008942255 6:57059898-57059920 GAGGTGAAAGAGACAGGGCAAGG - Intergenic
1010943035 6:81941682-81941704 GAGCTTGAATAGGTTGGGCAAGG + Intergenic
1011482404 6:87808376-87808398 GAGCTTGAATAGATGGGATACGG - Intergenic
1011986957 6:93459192-93459214 GAGGTTAAGTAAATGGCCCAAGG - Intergenic
1012154718 6:95803922-95803944 GAGGTTAAATAAATGTTCCAAGG - Intergenic
1013004942 6:106063703-106063725 GAGATTAAAAAGATGGGGCAAGG + Intergenic
1015926953 6:138320274-138320296 GAGGCTAAATGGAGGAGGCAGGG + Intronic
1016668695 6:146674666-146674688 GATTTAAAATAGATGTGGCAAGG + Intronic
1016921293 6:149296791-149296813 GAGGTTAACTAGCTAGGCCAAGG + Intronic
1021642860 7:22756911-22756933 GAGGTAAAATTGATGAGGGATGG + Intergenic
1022307338 7:29159672-29159694 TAGGTTAAATAGGGGGGTCAGGG - Intronic
1022592898 7:31682987-31683009 GAGGGTAAAGGGAAGGGGCATGG + Intergenic
1024822693 7:53351971-53351993 AAGCTTTAATAGATGGGACACGG + Intergenic
1024886748 7:54150969-54150991 GAGGTTGAAAAGATGAGGGATGG - Intergenic
1029609715 7:101620362-101620384 GAGGTTAAATAGAAGAGGGCGGG + Intronic
1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG + Intronic
1033576394 7:142689397-142689419 GAGGTCAAACAGGTGGGTCAGGG + Intergenic
1034219919 7:149436274-149436296 GAGGTTAAATAGATGGGGCAAGG - Intronic
1034448014 7:151123216-151123238 GAGGCCAAAAAGAGGGGGCAAGG - Intronic
1040457890 8:47618061-47618083 GAGGTTTAATGTATTGGGCAAGG + Intronic
1041153196 8:54957462-54957484 GAGATAAAATAGAAGGGGAAGGG - Intergenic
1042849788 8:73205196-73205218 GAGGTGAGAAAGATGGGGAAGGG - Intergenic
1043526881 8:81106701-81106723 GAGAAAAAATAGAGGGGGCAGGG + Intronic
1044382883 8:91554830-91554852 GAGATTAAACAAATGTGGCAAGG + Intergenic
1044425664 8:92047056-92047078 GATGTTAAATGGATTGGACAGGG + Intronic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1047070725 8:121340191-121340213 TATCTTAAGTAGATGGGGCAAGG + Intergenic
1047666722 8:127099689-127099711 GAGGTTAAATAGCTGGTCCGAGG + Intergenic
1048923201 8:139249058-139249080 AAGGTTAAATAGTAGGTGCAAGG + Intergenic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1050211040 9:3256410-3256432 GAAGTTAAATAGATGGTTCTGGG + Intronic
1050284889 9:4090962-4090984 GAGGTTAAATACATTGCTCAAGG - Intronic
1052285958 9:26786085-26786107 GAGTTCAAATGGATGGGACATGG - Intergenic
1058618293 9:106859695-106859717 GAGGTTAAACATAAGGGGAATGG - Intergenic
1059790612 9:117637978-117638000 GAGGTTAAATGGCTGGCCCAAGG - Intergenic
1059874393 9:118618088-118618110 GAGGTTAAATAGGTAAGGCAGGG - Intergenic
1060515164 9:124261007-124261029 GAGGTTAAGTAACTTGGGCAGGG + Intronic
1061596224 9:131631069-131631091 GAAGTTAAACAGTTGGGGCGGGG - Intronic
1203698563 Un_GL000214v1:117653-117675 GAGGTGAAAGAAATGGGGGATGG + Intergenic
1203699482 Un_GL000214v1:123804-123826 GAGGTGAAAGAAATGGGGGATGG + Intergenic
1203700428 Un_GL000214v1:130087-130109 GAGGTGAAAGAAATGGGGGATGG + Intergenic
1203701343 Un_GL000214v1:136107-136129 GAGGTGAAAGAAATGGGGGATGG + Intergenic
1203480174 Un_GL000224v1:4690-4712 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1203481141 Un_GL000224v1:11018-11040 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1203482105 Un_GL000224v1:17327-17349 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1203568132 Un_KI270744v1:108798-108820 GAGGTGAAAGAAATGGGGGAGGG + Intergenic
1187275520 X:17813566-17813588 GAGATCAAATAAAGGGGGCAGGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188369610 X:29352615-29352637 GAGGCTAAAGAGATGGGGATGGG - Intronic
1188786399 X:34352008-34352030 GAGGTTAAATAACTTGCGCATGG + Intergenic
1192845510 X:74903022-74903044 GAGGGAAAATAGATGTGGAAAGG + Intronic
1194732465 X:97471883-97471905 GAAGTTAAGTAGCTTGGGCAAGG + Intronic
1196595689 X:117543042-117543064 GAGGTGGAATATATGGGGTAGGG + Intergenic
1198167856 X:134074792-134074814 GAATATAAATAGATGGGTCATGG + Intergenic
1198249478 X:134866305-134866327 GGGGTTAGATCGATGGTGCAGGG - Intergenic