ID: 1034222896

View in Genome Browser
Species Human (GRCh38)
Location 7:149459867-149459889
Sequence CCTCGGGGCCGCGTGTGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034222889_1034222896 -8 Left 1034222889 7:149459852-149459874 CCTCCGGGCGCCCCACCTCGGGG 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1034222896 7:149459867-149459889 CCTCGGGGCCGCGTGTGTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 108
1034222883_1034222896 11 Left 1034222883 7:149459833-149459855 CCCGCAGGGAGCGAGCGCGCCTC 0: 1
1: 0
2: 2
3: 12
4: 92
Right 1034222896 7:149459867-149459889 CCTCGGGGCCGCGTGTGTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 108
1034222882_1034222896 12 Left 1034222882 7:149459832-149459854 CCCCGCAGGGAGCGAGCGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 48
Right 1034222896 7:149459867-149459889 CCTCGGGGCCGCGTGTGTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 108
1034222884_1034222896 10 Left 1034222884 7:149459834-149459856 CCGCAGGGAGCGAGCGCGCCTCC 0: 1
1: 0
2: 1
3: 10
4: 91
Right 1034222896 7:149459867-149459889 CCTCGGGGCCGCGTGTGTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034222896 Original CRISPR CCTCGGGGCCGCGTGTGTGC CGG Intronic
900496000 1:2976474-2976496 CCTGGGGCCAGCGTGGGTGCTGG + Intergenic
900626567 1:3611296-3611318 CGCCGGGGCCGCCTGTGAGCCGG - Exonic
902770533 1:18643113-18643135 CCTCGGGGCCTCTTTTGAGCTGG - Intronic
903324751 1:22563495-22563517 GCTGGGAGCCGCGTGTGCGCCGG + Intergenic
905075672 1:35268840-35268862 CCACGGGTCCGCGCGTGGGCGGG - Intergenic
907126421 1:52055057-52055079 TCTCGGGGCCACCTGTTTGCTGG - Exonic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
922882676 1:228992846-228992868 CCAAGGGGCCCCGGGTGTGCTGG - Intergenic
924615165 1:245606346-245606368 CCTCGGGGCAGCGTGCCTCCCGG - Intronic
1063462651 10:6224288-6224310 CCCCGGGGCCGCTTGCCTGCAGG + Intronic
1067111919 10:43407411-43407433 GCTCGGCTCCGCGTGTGTCCCGG - Intronic
1067338250 10:45381102-45381124 CCTCAGAGCCGCCTGTGTCCTGG + Intronic
1067772352 10:49135933-49135955 CCTCGGTGCTGGGTGTGTGGGGG - Intergenic
1071564168 10:86663047-86663069 CCTCGGGGCCAGGTGTGCCCAGG + Intronic
1076831535 10:132996752-132996774 CCTCCGGGCCGGATGTGTCCAGG - Intergenic
1077095655 11:797978-798000 CCTCGGGGACACGTATGTGCGGG + Exonic
1077130947 11:972244-972266 CCTCGTAGCCGGGTATGTGCCGG + Exonic
1077200084 11:1302379-1302401 CCTCTTGGCCGTGAGTGTGCAGG - Intronic
1077412986 11:2412086-2412108 CCTCAGGGCGGCTTGTGGGCAGG - Intronic
1077476336 11:2792153-2792175 CCTGGAGGCCGCGGGAGTGCGGG - Intronic
1083740956 11:64711581-64711603 CCTCCGGGCAGCGCGGGTGCTGG + Intronic
1084588798 11:70078587-70078609 CATCGTGGCCGCCTGTGCGCTGG - Exonic
1087901308 11:103644936-103644958 CTTCTGGGCCGCGTTTGTTCCGG - Intergenic
1090108227 11:123874691-123874713 CCTCGGGCCCTGGTGTGTGATGG + Intergenic
1091915889 12:4271697-4271719 GTTCGGGGCCGACTGTGTGCGGG + Intergenic
1095559680 12:43551154-43551176 CCTCGGAGCTGCGTTTCTGCCGG + Exonic
1097232891 12:57522962-57522984 CCTCTGGGCCGCGACTGCGCAGG + Exonic
1104833434 12:131770905-131770927 CCTGGGGACCGCATGTGTGTGGG + Intronic
1110707131 13:78608824-78608846 CCTCGGAGCCGCGCTTGTGGGGG - Intergenic
1114219951 14:20687466-20687488 CCATGGGGCTGTGTGTGTGCAGG + Intronic
1122081555 14:99270817-99270839 CCTCCGAGCGGCGTGTGTGGCGG - Intronic
1122601777 14:102925241-102925263 CCTGGGGCCCCCGCGTGTGCGGG + Intronic
1122619298 14:103045450-103045472 CCTCGGGGCTGGGAGGGTGCAGG - Intronic
1122842364 14:104472685-104472707 CCTCCGGGCGTCGGGTGTGCAGG - Intergenic
1122861889 14:104586510-104586532 CGTGGGGCCCGCGGGTGTGCAGG + Exonic
1123105431 14:105839191-105839213 CTTCGGGGCCCCATCTGTGCTGG - Intergenic
1124363295 15:29054322-29054344 CCTCGTGGCCGTGGGGGTGCGGG - Exonic
1124743132 15:32315373-32315395 CCTCGGGGCCGCGCCGGGGCCGG - Intergenic
1125541325 15:40471429-40471451 CCTCGCGGCCGGGCGGGTGCAGG - Exonic
1127794530 15:62426629-62426651 ACTGGGGGCCCCGGGTGTGCTGG + Intronic
1130932324 15:88438357-88438379 CCTCGGGGCTGCGTGACTGATGG - Intergenic
1132565125 16:618708-618730 ACTCAGGGCCATGTGTGTGCAGG + Intronic
1132565160 16:618949-618971 ACTCAGGGCCATGTGTGTGCAGG + Intronic
1134187775 16:12098085-12098107 CCTCTGGGCCCAGCGTGTGCGGG - Intronic
1136068024 16:27771675-27771697 CCTCGGGGCCCAGAATGTGCTGG - Intronic
1137599197 16:49744480-49744502 CCGCCTGGCCTCGTGTGTGCTGG - Intronic
1146322630 17:31858906-31858928 CCGCGGGGCCGCGGGGCTGCGGG - Intronic
1146823187 17:36000867-36000889 CCTTGGGGCCCCGTGTGTCACGG + Intronic
1148744402 17:49910366-49910388 CCGCGGTGCCGCGTTTGAGCCGG + Intergenic
1150322745 17:64230237-64230259 CCCAGGGGCCCCGTGTGAGCTGG + Intronic
1150819651 17:68425077-68425099 CCTCGGGGCTGGCTGAGTGCTGG - Intronic
1152461257 17:80443681-80443703 CCTCGGGCCCGTCCGTGTGCCGG - Intergenic
1152750801 17:82061633-82061655 CCTCCGGGACACGGGTGTGCAGG - Exonic
1152797695 17:82316206-82316228 CCTGGGGGTGGCGTGTGTGCTGG - Exonic
1152942030 17:83177860-83177882 CCTCCTTGCCGCTTGTGTGCCGG + Intergenic
1160364576 18:78313267-78313289 CCTGGGGACGGCGTGTGTCCTGG + Intergenic
1161325496 19:3661816-3661838 CCTCAGAGCCACGTGTGTGCTGG + Intronic
1163830378 19:19544650-19544672 CCTCGGGCCCCCGGGTGCGCCGG + Exonic
1164625435 19:29724487-29724509 CCCCGGGGCCCCATCTGTGCCGG + Intergenic
1166047077 19:40235936-40235958 CCTCGGGGCTGAGCGTGCGCGGG + Exonic
925278834 2:2669154-2669176 CCACCGGGCCATGTGTGTGCTGG - Intergenic
929896699 2:45967047-45967069 CCTCAGGGCCAGGGGTGTGCTGG + Intronic
933770859 2:85743088-85743110 CCTCTGGGCTGAGTGTGTCCAGG + Intergenic
934761738 2:96860486-96860508 CCTCATGGCCGGGTGGGTGCTGG + Exonic
937221556 2:120345485-120345507 GCTCGGCGCCGCCTGTGAGCGGG + Intergenic
938397879 2:130964029-130964051 GCTCGGGCCCGCCTGCGTGCGGG + Intronic
946372019 2:219286616-219286638 CCGCGGGGGCGTGTGTGTGGTGG + Exonic
946422852 2:219574779-219574801 CCTGGCGGCTGCGTGTATGCTGG - Exonic
1176104259 20:63378294-63378316 CCCCGGGGCCGGGGGTGTGATGG + Intronic
1179797738 21:43795045-43795067 TCTGGGGGCCGGCTGTGTGCTGG + Intronic
1179830752 21:43994529-43994551 CCTCGGGGGCGGGTGTGGACAGG - Intergenic
1180167540 21:46037806-46037828 CCCCGAAGCCGCGTGTGTGGAGG - Intergenic
1180969138 22:19805941-19805963 CCTCGGGGCCGCTCATGTCCAGG - Intronic
1180997652 22:19973415-19973437 CCTGGAGACCGCCTGTGTGCAGG + Intronic
1184294571 22:43515464-43515486 CCTCGGGGCCACCTGTGGGTTGG - Intergenic
1184401740 22:44278571-44278593 CCCAGGGGCGGCCTGTGTGCTGG + Intronic
1184455496 22:44607557-44607579 CCTCTTGGCCGTGTGTGTTCGGG - Intergenic
1184747538 22:46464953-46464975 CCTCGGCCCCTCCTGTGTGCTGG - Intronic
1184787427 22:46678552-46678574 CCGCGGGCCTGCGTGTCTGCTGG + Exonic
1185111361 22:48901961-48901983 CCTGGGGGCCCCGTCCGTGCCGG - Intergenic
1185111548 22:48902807-48902829 CCTGGGGGCCCCGTCCGTGCCGG + Intergenic
1185249255 22:49791160-49791182 CCCCGGGGCTGCGTGTCAGCTGG - Intronic
952334373 3:32392028-32392050 CAGCAGGGCCGCGTGGGTGCGGG - Exonic
954660879 3:52226230-52226252 CCTAGAGGCCAGGTGTGTGCTGG + Intergenic
954809669 3:53240282-53240304 CCTCGGGGCCGCTTGTGGGATGG - Exonic
961186158 3:124917011-124917033 CCTCTGGGTCGTGTGTGTCCAGG - Intronic
961557547 3:127706934-127706956 CCTCTGGGCAGCATGGGTGCAGG + Intronic
968273425 3:197422367-197422389 CCTCAGAGCCTCCTGTGTGCTGG - Intergenic
978741910 4:112145950-112145972 CCCCGGGGTCGCGTGTCTGGCGG + Intronic
980114813 4:128669204-128669226 CCCCAGGTCCACGTGTGTGCTGG + Intergenic
985537917 5:474920-474942 CCTCGGGGCCGTCTGCCTGCAGG + Exonic
1002425439 5:179171989-179172011 CCTCGGGGCCGGGGGTAAGCTGG + Intronic
1002888644 6:1316533-1316555 CCCCGGGGCTGGGTGTGTGAAGG - Intergenic
1004381125 6:15133480-15133502 CCTAGGGGCAGGATGTGTGCAGG - Intergenic
1013538758 6:111087574-111087596 CCTCGCGGCCGCCTGCGCGCTGG + Exonic
1018838080 6:167500083-167500105 CCTCTGGGCCCCTTGTGGGCAGG - Intergenic
1019192010 6:170256974-170256996 CCTCGGCGCCACCTGGGTGCTGG - Intergenic
1019280182 7:195751-195773 ACTCAGGGCCGTCTGTGTGCCGG + Intronic
1019396522 7:822887-822909 CCACAGGGCCGTGTGTGTGCGGG - Intronic
1019396531 7:822923-822945 CCACAGGGCCGTGTGTGTGTGGG - Intronic
1019396540 7:822959-822981 CCACAGGGCCGTGTGTGTGTGGG - Intronic
1019396549 7:822995-823017 CCACAGGGCCACGTGCGTGCGGG - Intronic
1019492866 7:1323245-1323267 CCGCGGGCCCGCGAGTGGGCAGG - Intergenic
1034222896 7:149459867-149459889 CCTCGGGGCCGCGTGTGTGCCGG + Intronic
1035028654 7:155843646-155843668 CCGCGGGGCCTGGTGTCTGCGGG + Intergenic
1035769736 8:2137510-2137532 CCACGGGTCTGTGTGTGTGCAGG + Intronic
1037262781 8:17027132-17027154 CCCCGGGGCCGCGCGAGTGTAGG + Intergenic
1049434927 8:142582136-142582158 CCTCAGGGCCACGTGTGCTCAGG - Intergenic
1049530039 8:143149460-143149482 CTTCGAGGCCCCGTGTGTGCTGG - Intergenic
1055321743 9:75088809-75088831 GCTCGGGGCCGGGTGCGCGCCGG - Intronic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1061818333 9:133208951-133208973 CCTCGGGGGGCCGTGTCTGCTGG + Intronic
1062242118 9:135546407-135546429 CCTCGGGGGGCCGTGTCTGCTGG - Intronic
1062343462 9:136103970-136103992 CCTCATGGCCGTGTGTCTGCTGG + Intergenic
1062368326 9:136222801-136222823 CCTCTGGTCTGCGTGTGTGGAGG + Intronic
1062517601 9:136944204-136944226 CCACGGGGCTGCGTGTCTGCAGG + Intronic