ID: 1034222898

View in Genome Browser
Species Human (GRCh38)
Location 7:149459872-149459894
Sequence GGGCCGCGTGTGTGCCGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034222889_1034222898 -3 Left 1034222889 7:149459852-149459874 CCTCCGGGCGCCCCACCTCGGGG 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1034222898 7:149459872-149459894 GGGCCGCGTGTGTGCCGGGCCGG 0: 1
1: 0
2: 2
3: 39
4: 280
1034222882_1034222898 17 Left 1034222882 7:149459832-149459854 CCCCGCAGGGAGCGAGCGCGCCT 0: 1
1: 0
2: 0
3: 9
4: 48
Right 1034222898 7:149459872-149459894 GGGCCGCGTGTGTGCCGGGCCGG 0: 1
1: 0
2: 2
3: 39
4: 280
1034222891_1034222898 -6 Left 1034222891 7:149459855-149459877 CCGGGCGCCCCACCTCGGGGCCG 0: 1
1: 0
2: 2
3: 19
4: 246
Right 1034222898 7:149459872-149459894 GGGCCGCGTGTGTGCCGGGCCGG 0: 1
1: 0
2: 2
3: 39
4: 280
1034222884_1034222898 15 Left 1034222884 7:149459834-149459856 CCGCAGGGAGCGAGCGCGCCTCC 0: 1
1: 0
2: 1
3: 10
4: 91
Right 1034222898 7:149459872-149459894 GGGCCGCGTGTGTGCCGGGCCGG 0: 1
1: 0
2: 2
3: 39
4: 280
1034222883_1034222898 16 Left 1034222883 7:149459833-149459855 CCCGCAGGGAGCGAGCGCGCCTC 0: 1
1: 0
2: 2
3: 12
4: 92
Right 1034222898 7:149459872-149459894 GGGCCGCGTGTGTGCCGGGCCGG 0: 1
1: 0
2: 2
3: 39
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034222898 Original CRISPR GGGCCGCGTGTGTGCCGGGC CGG Intronic
900105222 1:978212-978234 GGGGCGGGCGTGTGCGGGGCAGG - Intronic
900355479 1:2260163-2260185 GGCCAGCGTGTGTGGTGGGCGGG + Intronic
900516209 1:3083385-3083407 GGGCCTGCTGTGTGCCGGGCGGG + Intronic
900523332 1:3116586-3116608 GGGCAGCCTCTGTCCCGGGCGGG - Intronic
900561693 1:3310245-3310267 GGCCCCAGAGTGTGCCGGGCAGG - Intronic
900581720 1:3412840-3412862 GGGCCGCGGCGGTGCTGGGCGGG + Intronic
900590122 1:3455673-3455695 GGGGTGCGTGTGGGCCTGGCTGG + Intronic
900786995 1:4655485-4655507 TGGGCGCGTGGGTGCCAGGCTGG + Intronic
901641116 1:10693758-10693780 GGGCCGGGTGGGGGCCGGGAGGG - Intronic
901930799 1:12595408-12595430 GGGCCGCGGGGGTCCCGGGAGGG + Intronic
902919736 1:19658564-19658586 GTGCCGCGTGGGGGCCAGGCAGG - Intergenic
904696831 1:32335832-32335854 GGGCGCCGCGTGTCCCGGGCCGG + Intronic
914702835 1:150149988-150150010 GGGCCGCGTGGGCGCCGGGATGG + Exonic
919761056 1:201098576-201098598 GAGCCTCCTGTGTGCTGGGCAGG - Intronic
920249043 1:204610210-204610232 GAGCTGCGTGTGTGGCAGGCAGG - Intergenic
922423507 1:225474583-225474605 GGGCCTAGAGAGTGCCGGGCTGG - Intergenic
922569631 1:226626406-226626428 GGGCTTCCTGTGTGCTGGGCAGG - Intergenic
923623361 1:235595206-235595228 GGGCCCCGTGTCTGCCGTGGAGG + Intronic
1063064962 10:2599446-2599468 GGCCCGCATGTGTGCTGTGCTGG - Intergenic
1064011859 10:11742302-11742324 GGGCCTCGTGGGGGCGGGGCGGG + Intergenic
1065024190 10:21526007-21526029 GGGCCGCGCTCGTGCCGAGCTGG + Intergenic
1073003311 10:100301576-100301598 TGGCTGCCTGTGGGCCGGGCAGG - Intronic
1074088693 10:110227174-110227196 GGGTCGCGCGTGTGCGGGGAGGG + Intronic
1076139227 10:128066292-128066314 GGGCTGCGACAGTGCCGGGCTGG - Intronic
1076404517 10:130202953-130202975 GGGCACCGTGTGTGCTGTGCAGG - Intergenic
1076576690 10:131474272-131474294 AGGCTGCGTGTGTGCAGGGAGGG - Intergenic
1076841379 10:133047562-133047584 GGGCCGGGTGTGCACTGGGCAGG - Intergenic
1076906623 10:133365593-133365615 CGGCTGCGTGTGCGCCTGGCAGG - Intronic
1077016459 11:400931-400953 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016467 11:400947-400969 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016498 11:401024-401046 GGGCCGGGTGTGAGCGGGGCGGG - Intronic
1077016511 11:401055-401077 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016519 11:401070-401092 GGGCCGGGTGTGAGCGGGCCGGG - Intronic
1077016525 11:401086-401108 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016530 11:401102-401124 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016535 11:401117-401139 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016548 11:401148-401170 GGGCCGGGTGTGAGCGGGGCAGG - Intronic
1077016554 11:401164-401186 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016560 11:401180-401202 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016569 11:401210-401232 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016578 11:401226-401248 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016587 11:401257-401279 GGGGCGGGTGTGAGCGGGGCGGG - Intronic
1077016593 11:401272-401294 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016605 11:401302-401324 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016613 11:401317-401339 GGGCCGGGTGTGAGCGGGCCGGG - Intronic
1077016619 11:401333-401355 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016624 11:401349-401371 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016629 11:401364-401386 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016637 11:401380-401402 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016642 11:401395-401417 GGGCCGGGTGTGAGCGGGGCGGG - Intronic
1077016649 11:401411-401433 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016657 11:401441-401463 GGGGCGGGTGTGAGCGGGGCGGG - Intronic
1077016662 11:401456-401478 GGGGCGGGTGTGAGCGGGGCGGG - Intronic
1077016668 11:401471-401493 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016677 11:401487-401509 GGGCCGGGGGTGAGCGGGGCCGG - Intronic
1077016688 11:401518-401540 GGGGCGGGTGTGAGCGGGGCGGG - Intronic
1077016694 11:401533-401555 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016710 11:401564-401586 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016715 11:401580-401602 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016720 11:401595-401617 GGGCCGGGTGTGAGCGGGGCGGG - Intronic
1077016727 11:401611-401633 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016733 11:401627-401649 GGGCCGGGTGTGAGCGGGGCCGG - Intronic
1077016738 11:401643-401665 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016750 11:401673-401695 GGGCCGGGGGTGAGCGGGGCGGG - Intronic
1077016759 11:401689-401711 GGGCCGGGGGTGAGCGGGGCCGG - Intronic
1077017160 11:402557-402579 GGGCCGGGGGTGAGCGGGGCCGG - Intronic
1077017269 11:402794-402816 GGGCCGGGGGTGAGCGGGGCCGG - Intronic
1077048545 11:556517-556539 GGTCCGGGTCTGTGCAGGGCTGG + Exonic
1077074478 11:694229-694251 GGGGCAGGTGTGTGCAGGGCAGG + Intronic
1077094547 11:793756-793778 GGGCCTGGTGTGTGCCAGGTGGG + Intronic
1077306682 11:1871735-1871757 GGGGGGTGTGTGTGGCGGGCAGG + Intronic
1077491373 11:2862423-2862445 GGGCCGCGGGCCTGGCGGGCGGG + Intergenic
1077578099 11:3399529-3399551 GGCCTGCCTGTGTGCCAGGCTGG - Intergenic
1081549306 11:44096585-44096607 GGCCCGGGGGTGTGTCGGGCCGG + Intronic
1081991783 11:47341973-47341995 GGGCGGTGAGTGTGCAGGGCAGG - Exonic
1082776022 11:57245032-57245054 GGGCTGGGTGTGAGCCGGCCTGG - Intergenic
1083195335 11:61082485-61082507 CTGCCGCGTGTGTACCAGGCTGG - Intergenic
1083611837 11:64008061-64008083 GGAGCGCTTGTGAGCCGGGCAGG + Intronic
1088469528 11:110177940-110177962 AGGCAGGGTGTGTGCTGGGCGGG - Intronic
1090199889 11:124846409-124846431 GAGACACATGTGTGCCGGGCTGG - Intergenic
1090799243 11:130160209-130160231 GGGCCGCGGGCGGGCGGGGCTGG + Intronic
1091224988 11:133951713-133951735 GGGCCCTGTGAGTGCCGGGCAGG - Intronic
1092193236 12:6534751-6534773 GGGAGGCGTGTGTGTCGGCCGGG + Intronic
1094385101 12:29885426-29885448 TGGCTGCCTGTGGGCCGGGCAGG - Intergenic
1096466125 12:51848512-51848534 GGGCCGCGGGCGGGCCGGGATGG - Intergenic
1097232894 12:57522967-57522989 GGGCCGCGACTGCGCAGGGCGGG + Exonic
1104918616 12:132279070-132279092 GGGCCGCGTGTGGGACGGCAGGG + Intronic
1104961536 12:132490459-132490481 GGGCTGAGTGTGCGCCGCGCGGG - Exonic
1104970267 12:132527769-132527791 GGGCTGCGGGGCTGCCGGGCAGG + Intronic
1105295911 13:19087821-19087843 GGGCTCAGTGTGTGCTGGGCAGG - Intergenic
1105956362 13:25287103-25287125 GGGCCGGGTCTCCGCCGGGCCGG + Intronic
1106109032 13:26760796-26760818 GGGGAGCGTGTGGGCCGGGCGGG - Intergenic
1113379222 13:109787027-109787049 GGGCCGCGGCTGGGCGGGGCGGG + Intergenic
1117547814 14:56807963-56807985 GGGCTGCGGGGCTGCCGGGCAGG - Intronic
1122310493 14:100791416-100791438 GGGGAGCCTGGGTGCCGGGCGGG - Intergenic
1122688776 14:103521995-103522017 GGGCTGCGGGCGGGCCGGGCGGG - Intronic
1122719637 14:103715175-103715197 GGGCCGCGTGCGTTCGGAGCGGG - Intronic
1122884843 14:104706373-104706395 GGGCAGCCTGGGGGCCGGGCTGG + Intronic
1122935425 14:104953828-104953850 GAGCCGGGTGGATGCCGGGCAGG - Exonic
1122985611 14:105210303-105210325 GGGCCGGGTGTGTGCAGGGCTGG - Exonic
1124142345 15:27088447-27088469 GGGGAGGCTGTGTGCCGGGCAGG + Intronic
1124218859 15:27832243-27832265 GGGGCCAGTGTGTGCAGGGCAGG - Intronic
1124628875 15:31326271-31326293 GGGAGGCGTGTCTGCCCGGCCGG - Intergenic
1124982743 15:34580783-34580805 AGGCAGCCTGTGTGCCTGGCAGG - Intronic
1127165819 15:56243947-56243969 GGGCCGCGGGCGCGACGGGCCGG + Intergenic
1128061193 15:64736959-64736981 GGGGCACGTGTGGGCAGGGCAGG + Intergenic
1128806515 15:70535097-70535119 GGGCCGGGGGGGTGCCTGGCAGG + Intergenic
1129152451 15:73697379-73697401 GGGGGGCGGGTGTGCCTGGCTGG + Intronic
1129986566 15:79923866-79923888 GGGCCAGGTGTGTGAGGGGCGGG + Intergenic
1132864304 16:2085985-2086007 CAGCCCCGTGTGTGCCTGGCCGG - Intronic
1133997961 16:10762260-10762282 GGGCCTCATCTGTGCCGTGCTGG - Intronic
1134056064 16:11170601-11170623 AGGCCACGTGTGGGCCGGGCGGG - Intronic
1141132392 16:81445056-81445078 GGGCGGCGCGTGCGGCGGGCTGG - Intergenic
1142671829 17:1491221-1491243 GCGCCCCGAGTGTGACGGGCGGG - Intronic
1143029600 17:3960410-3960432 GGGCCGCGTGTGGCCCGGGAAGG + Intronic
1143622302 17:8087638-8087660 GGCCGGGGTGGGTGCCGGGCAGG + Exonic
1144769555 17:17752161-17752183 GGCCCGTGGGTATGCCGGGCGGG - Intronic
1146281785 17:31549659-31549681 GGGCCGTGTGTGACCCTGGCCGG - Intergenic
1146322627 17:31858901-31858923 GGGCCGCGGGGCTGCGGGGCGGG - Intronic
1147310840 17:39595447-39595469 GACCAGCCTGTGTGCCGGGCTGG - Intergenic
1147317107 17:39626337-39626359 GGACTGCGTGTGTGCGGGGGAGG - Intergenic
1148284106 17:46372860-46372882 GGGCCGGGTGAGTGCCGGTCTGG + Intergenic
1148306327 17:46590781-46590803 GGGCCGGGTGAGTGCCGGTCTGG + Exonic
1148853274 17:50565045-50565067 GGGCGGGGTGAGTGCTGGGCGGG - Intronic
1151155920 17:72123013-72123035 GGGCAGGGGGTGTGCCAGGCGGG - Intronic
1151450102 17:74193579-74193601 GGTCAGCGTGTGTGGCTGGCTGG - Intergenic
1151546599 17:74797096-74797118 GGGCGGGGAGTGTGCCTGGCAGG - Intronic
1152245604 17:79183212-79183234 GGGGCGCACGTGCGCCGGGCCGG + Intronic
1152378424 17:79930161-79930183 AGGCCAGGCGTGTGCCGGGCGGG + Intergenic
1152558296 17:81065482-81065504 GGGCCGTGTGGGTGCCTGGGTGG + Intronic
1152637267 17:81435244-81435266 GGGCCACGCGTGGGCTGGGCGGG - Intronic
1152689538 17:81711914-81711936 GGGCCACGTGTGTGCGGCGTGGG - Intergenic
1152755502 17:82085429-82085451 GGGCCGGGTGAGGGCCAGGCGGG - Intronic
1152921909 17:83070087-83070109 AGCCCCCGTGTGTGCAGGGCTGG + Intergenic
1152990728 18:361569-361591 GGTCCGTGTGTGTGGTGGGCTGG - Intronic
1153285598 18:3451994-3452016 GAGCCGGGTGTCTGCCGGGGTGG + Exonic
1155193755 18:23453638-23453660 TGGCCGCGGGGGTGCCGGGATGG + Intronic
1155507790 18:26549034-26549056 GGGCGGCGGCTGCGCCGGGCGGG + Exonic
1156883871 18:42111984-42112006 TGGCTGCCTGTGGGCCGGGCAGG + Intergenic
1160584546 18:79905050-79905072 TGGCCGGGTGTGTTCAGGGCTGG + Intronic
1160724428 19:611384-611406 AGGCCGTGTGTGAGCCAGGCAGG + Intronic
1160836610 19:1127530-1127552 GGACCGTGTGGGTCCCGGGCTGG + Intronic
1160843510 19:1156808-1156830 GGGATGCGTGGGTGCCGGGCTGG + Intronic
1160939713 19:1614565-1614587 GGATAGCGTGTGGGCCGGGCCGG + Intronic
1161089202 19:2351829-2351851 GGGACGCGGGGGTGCCGGGTGGG + Intronic
1161212736 19:3076085-3076107 GCGCCGCGTGGGTGGGGGGCGGG - Intergenic
1161236649 19:3201620-3201642 ACGCCGCGTGAGTGCCGGGGTGG + Exonic
1161487429 19:4543651-4543673 GGGCCAAGTCTGTGCCCGGCCGG + Exonic
1161628600 19:5340261-5340283 GGCGCGCGTGTGTGCGGAGCCGG - Intronic
1162128248 19:8510887-8510909 GGGCCGCGGGGGCGCCGGGGCGG + Exonic
1162901065 19:13795719-13795741 GGGCCGCGCGTGGCCGGGGCCGG + Exonic
1163404293 19:17112824-17112846 GGGCTGGGTGAGTGCCTGGCTGG - Intronic
1163509411 19:17726230-17726252 GGACCGCGTGGATGCCGTGCTGG + Exonic
1163655602 19:18543355-18543377 GGGCCGCGGGGGTGGCGAGCCGG - Intronic
1165363876 19:35352213-35352235 GGGCCGCCTGGGTGGCCGGCGGG + Exonic
1165459503 19:35936443-35936465 GGGCCGGGCGGGGGCCGGGCTGG - Intronic
1166366414 19:42280642-42280664 GGCCCGCGTGGGTGTCAGGCCGG + Intronic
1166682556 19:44777907-44777929 GAGCCTCGCGTGTGCCGGGAAGG - Exonic
1167074266 19:47239537-47239559 GGGCCGGGTGGGGGCTGGGCGGG + Intergenic
1167125449 19:47545550-47545572 GGGCCGCGTGGGGGCCGGCTGGG + Exonic
1168241837 19:55092575-55092597 GGTCTGCGTGCGGGCCGGGCCGG - Intronic
926334872 2:11855542-11855564 GGGCCGACTGTGTCCCCGGCGGG + Intergenic
926705960 2:15837751-15837773 GTGCAGTGTGTGTGCAGGGCTGG + Intergenic
927088583 2:19693531-19693553 GGGGCACGTGAGTGCCAGGCAGG - Intergenic
930035074 2:47080214-47080236 GGGGAGTGTGTGTGCTGGGCAGG - Intronic
934121316 2:88842886-88842908 GGCCTGCGTGTGTGCCAGGGTGG + Intergenic
935237582 2:101151425-101151447 GGGCCACGTGAGGGCCGCGCTGG - Intronic
935361623 2:102250789-102250811 GGGCCGCGTGGGTGGCTGGGCGG + Intergenic
936047333 2:109197702-109197724 GGGCCGGGTGTGTGCCTTGCTGG + Intronic
936388788 2:112054575-112054597 GGGCCGCGTGGAGGCGGGGCCGG - Intergenic
937126650 2:119478863-119478885 GGCCCTCTTCTGTGCCGGGCCGG - Exonic
937866232 2:126753467-126753489 GGGTCGTGTGTGTGCAGGGCAGG - Intergenic
938639679 2:133266145-133266167 GGGCTGCGTGGGAGCTGGGCGGG + Intronic
938727571 2:134121049-134121071 GGGCCGGGAGTGGGCCGGGGCGG - Intronic
939900443 2:147844375-147844397 GCGCAGCGCGCGTGCCGGGCCGG - Intergenic
941111764 2:161424238-161424260 GGGCCGCGGCGGGGCCGGGCGGG - Exonic
941808643 2:169734224-169734246 TGGCCGCGCGGGCGCCGGGCCGG + Intronic
942452422 2:176116512-176116534 GGGACGCGAGTGGGGCGGGCTGG + Intronic
942890484 2:180980993-180981015 GGGCCGCGTGGGGGGCGGCCGGG + Intronic
944861571 2:203820055-203820077 GGGTCACGTGTGTGCCAGGCTGG + Intergenic
947276519 2:228397753-228397775 TGGCTGCCTGTGGGCCGGGCAGG - Intergenic
947710755 2:232314160-232314182 GGGCCCAGTGGGTGCTGGGCCGG - Intronic
947860477 2:233354437-233354459 GGGCCGAGGGCGGGCCGGGCCGG - Intergenic
948473695 2:238203329-238203351 GGGCCGCCAGTGGGCCGGACGGG + Intronic
1172118363 20:32584322-32584344 GGGCCGTGGCCGTGCCGGGCAGG - Intronic
1173741554 20:45405989-45406011 GGGCGGGGTGGGCGCCGGGCCGG - Intronic
1174392027 20:50223593-50223615 CGGCGGCCTGTGGGCCGGGCCGG + Intergenic
1174571880 20:51507965-51507987 GGCCCTCGTGTGTGCTGGGCAGG - Intronic
1175783105 20:61696127-61696149 GGGCCATGTCTGTGCCAGGCTGG + Intronic
1176129023 20:63488438-63488460 GGGCGGCGTGTGGGCGGGGCCGG + Intronic
1178422009 21:32450727-32450749 GGCCTGCCTGTGTGCCAGGCGGG + Intronic
1178610354 21:34073903-34073925 GGGGCGCGCGTGGGCCGGCCGGG + Intronic
1179923727 21:44521439-44521461 GGGCAGCGTGGGGGCCGGGTCGG - Intronic
1180089394 21:45526052-45526074 GGACCCCGTGGCTGCCGGGCGGG - Intronic
1180581944 22:16846092-16846114 GGGCCTGGTGTGTGGAGGGCAGG - Intergenic
1180959490 22:19756160-19756182 GAGCCACGTGTGTGCAGGGGAGG + Intergenic
1181028229 22:20137792-20137814 GTGCTGCCTGTGTGCCAGGCAGG + Intronic
1181407384 22:22694563-22694585 GGGCCCTGTGTGTGGTGGGCAGG + Intergenic
1181415382 22:22755330-22755352 GGGCCCTGTGTGTGGTGGGCAGG + Intronic
1181466634 22:23113949-23113971 GGGCTGCCTGTCTGCTGGGCAGG - Intronic
1182076598 22:27499402-27499424 GGGCTGTGTCTGGGCCGGGCTGG - Intergenic
1182115671 22:27754969-27754991 GGGCCTGGTGTGTGCAGGGTCGG - Intronic
1182667633 22:31971058-31971080 AGGAGGCGTGTGAGCCGGGCTGG - Intergenic
1182706388 22:32283213-32283235 GGGGCAGGTGTGTGCCTGGCAGG - Intergenic
1182851386 22:33477596-33477618 GGGGTGCGTGTGTGCATGGCTGG - Intronic
1183293996 22:37019384-37019406 GGGGCGAGTGAGTGCGGGGCGGG - Exonic
1183490400 22:38112616-38112638 GGGCGGGGTGCGGGCCGGGCGGG - Intronic
1183630631 22:39030346-39030368 GAGCCGTCTGTGTGCTGGGCAGG + Intronic
1183634086 22:39050438-39050460 GAGCCGTCTGTGTGCTGGGCAGG + Intronic
1183733463 22:39630892-39630914 GGGCAGAGTGTGTGCAGGGCTGG + Intronic
1183956280 22:41382256-41382278 GGGCCTCGTGAGGGCGGGGCCGG + Intronic
1184141265 22:42578714-42578736 GTGCAGCATGTGTGCCGGGAAGG - Intergenic
1184276333 22:43411585-43411607 GGGCCGCGCGCGGGCTGGGCAGG - Intronic
1184486468 22:44783035-44783057 GGGGAGCGTGTGTATCGGGCTGG - Intronic
1184645016 22:45890849-45890871 GGGGCGTGTGTGTGCGGGGCAGG + Intergenic
1185042363 22:48511692-48511714 AGGGCCTGTGTGTGCCGGGCCGG - Intronic
1185098208 22:48822916-48822938 GGGCGGTGTGTGTGCCCAGCTGG - Intronic
1185322327 22:50207520-50207542 GGGCGGCTGGTGTCCCGGGCAGG - Intronic
1185330116 22:50248664-50248686 CGGCCGGGTCTGTGCCGTGCTGG - Exonic
950772492 3:15323454-15323476 GGGCCCCCTGTGTGCTTGGCTGG - Intronic
953179747 3:40584277-40584299 GGGCCGGGTGTCTTCTGGGCTGG + Intergenic
953439621 3:42906435-42906457 GCGCCGGGTGAGTGCGGGGCCGG + Exonic
954036089 3:47852037-47852059 GGGCCCCTTGTGTGCCTGACCGG + Exonic
954428527 3:50456634-50456656 GGGCAGAGTGTGTGAGGGGCAGG - Intronic
958900100 3:99876089-99876111 GGGCCGGGCGGGGGCCGGGCCGG + Intronic
961881597 3:130065310-130065332 GGCCTGCCTGTGTGCCAGGCAGG - Intergenic
962202400 3:133412625-133412647 GGGCAGTCTGGGTGCCGGGCAGG + Intronic
964751649 3:160059278-160059300 GGGGTGCCTGTGTGCCAGGCAGG + Intergenic
966188363 3:177248282-177248304 GGGGGGCGTGTGGGGCGGGCAGG - Intergenic
968618272 4:1592289-1592311 GGGCCGCGTGTGGACGTGGCTGG - Intergenic
968652178 4:1764661-1764683 GGGCCGAGTGTGAGCCTGGCTGG + Intergenic
968814210 4:2813265-2813287 GGGCCGTGGCTGTGCTGGGCCGG + Intronic
968820193 4:2844094-2844116 GGGCCGCGGTTGCGGCGGGCGGG + Intronic
968993910 4:3933415-3933437 GGCCTGCCTGTGTGCCAGGCGGG - Intergenic
969114079 4:4860401-4860423 GGGCCGGGTGGGGGCCGGGTGGG + Intronic
969416985 4:7067516-7067538 GGGCCGGGTGTGCCCTGGGCAGG - Intronic
969822317 4:9730172-9730194 GGCCTGCCTGTGTGCCAGGCGGG + Intergenic
978576688 4:110196690-110196712 GGGCCGCGTCTGGCCCGAGCCGG - Intronic
984928379 4:184826087-184826109 GGGCCGCGGGAGGGCGGGGCCGG - Intronic
985653280 5:1116914-1116936 GGGCTGCGTGTCTGCCAGGTTGG - Intergenic
988500107 5:31777147-31777169 GGGCAGCGTGAGTTCCGGGTGGG + Intronic
990321314 5:54632499-54632521 AGCCTGCGTGTGTGCTGGGCTGG - Intergenic
997232923 5:132257262-132257284 GGGCCGCAGGTGTGCCAGTCGGG + Intronic
1001345750 5:170896887-170896909 GGGGCGCTTGTGAGCCGCGCCGG - Intronic
1001988219 5:176094039-176094061 GGTCCGTGTGTCTGGCGGGCGGG + Intronic
1002228649 5:177744101-177744123 GGTCCGTGTGTCTGGCGGGCGGG - Intronic
1002347166 5:178556043-178556065 GGGCTGCGTGTGTGCTGTGATGG - Intronic
1002525885 5:179816028-179816050 GGGCTGCGAGTGTGCAGAGCTGG + Intronic
1003802060 6:9681105-9681127 TGGCTGCCTGTGTGCCGGGCGGG - Intronic
1004381122 6:15133475-15133497 GGGCAGGATGTGTGCAGGGCGGG - Intergenic
1005768195 6:29036189-29036211 TGGCCGCGGGTGTGCCGGGCGGG - Intergenic
1006171746 6:32097140-32097162 GGCGTGTGTGTGTGCCGGGCAGG - Intronic
1014931590 6:127343106-127343128 GGGCCGGCTGTGCGCCGGCCGGG - Intronic
1016789687 6:148055046-148055068 TGGCTGCCTGTGGGCCGGGCAGG - Intergenic
1019292131 7:256023-256045 AGGCCGAGTGAGTGCGGGGCCGG + Exonic
1019421846 7:954365-954387 GGGCCGGGTGGGCGCGGGGCCGG - Intronic
1019529095 7:1494775-1494797 GGGGCTCCTGTGTGCCGGGCTGG - Intronic
1020274377 7:6615704-6615726 GGGCCGCGCGGGGGCCGGGGCGG - Exonic
1022114684 7:27251680-27251702 CGGGCGCGTGTGGCCCGGGCTGG + Intergenic
1023417917 7:39949962-39949984 GGGCAGCGACTGTGCGGGGCTGG - Intergenic
1024891989 7:54213558-54213580 TGGCTGCCTGTGGGCCGGGCAGG - Intergenic
1026913494 7:74106325-74106347 GGGCTGCATTTGTGCAGGGCTGG - Intronic
1027185738 7:75969535-75969557 GTGCCCCGTGAGTGCCTGGCGGG - Intronic
1031513863 7:122679132-122679154 TGGCTGCCTGTGGGCCGGGCAGG + Intronic
1032916438 7:136495384-136495406 GGGCCGGGTGGGGGCCGGTCTGG - Intergenic
1033677116 7:143553574-143553596 TGGCTGCCTGTGGGCCGGGCAGG - Intergenic
1033694719 7:143775863-143775885 TGGCTGCCTGTGGGCCGGGCAGG + Intergenic
1033732822 7:144195626-144195648 GGGCCGCGGGTGGGGCGGCCGGG - Exonic
1033750229 7:144355391-144355413 GGGCCGCGGGTGGGGCGGCCGGG + Exonic
1034222898 7:149459872-149459894 GGGCCGCGTGTGTGCCGGGCCGG + Intronic
1034522536 7:151632025-151632047 GGGCCGTGGGAGCGCCGGGCCGG + Intronic
1034972255 7:155426656-155426678 GGGTCGTGGGTGTGCTGGGCTGG + Intergenic
1035021616 7:155804040-155804062 AGGCCGGGTGTGTGCGGAGCTGG - Intronic
1035266097 7:157690999-157691021 CGGCCGGGTGCGCGCCGGGCCGG - Intronic
1035366279 7:158350949-158350971 GGGCCACAGGTGTGCCGGGTGGG - Intronic
1036811150 8:11868244-11868266 GGGCGGGGGGTGTGCGGGGCCGG - Intronic
1037787830 8:21912886-21912908 GGGCGGCGTGTGACCCGGGCTGG + Intronic
1037902138 8:22694575-22694597 GGGCGGCCTGTGTGCCGACCCGG + Intergenic
1039111417 8:34044204-34044226 TGGCTGCCTGTGGGCCGGGCAGG - Intergenic
1041384159 8:57280485-57280507 GGGCCGGGTGGGGGCTGGGCTGG + Intergenic
1042216362 8:66432569-66432591 GCGCAGCGTGAGTGCGGGGCCGG + Exonic
1045148723 8:99378257-99378279 TGGCTGCCTGTGGGCCGGGCAGG - Intronic
1048063676 8:130946681-130946703 GGGCCAACTGTGTGCTGGGCAGG - Intronic
1048472086 8:134712831-134712853 GGGCGGCAGGTGAGCCGGGCTGG - Exonic
1049257758 8:141623004-141623026 GGGCCACGTGTGCTCCGGGCGGG - Intergenic
1049287770 8:141785803-141785825 GTGCAGGGTGTGGGCCGGGCCGG + Intergenic
1049542662 8:143215538-143215560 GGGCCGGGGGTGAGCCGGGTGGG - Intergenic
1049605529 8:143527468-143527490 GGATCGCGTGTGTGCCGTGGTGG - Intronic
1049726195 8:144147611-144147633 GGGCCGCGCGAGTCCAGGGCGGG + Intergenic
1049771308 8:144383270-144383292 GGGCGGGGTGTGTGCGGTGCAGG + Intronic
1049786799 8:144454766-144454788 GGGCCCCACGTGTGCAGGGCTGG - Intronic
1053412810 9:37926615-37926637 GGGTCGTGTGTCTGCCTGGCAGG - Intronic
1056578332 9:87872412-87872434 GGGCTGCCTGTGTGCCAGGCTGG - Intergenic
1056702696 9:88924261-88924283 AGGCCGTGTGTGTGCCTGCCTGG - Intergenic
1057245509 9:93451605-93451627 GGGCGGCGTCCGCGCCGGGCGGG + Intronic
1057355120 9:94325825-94325847 GGGCGGCCTGTGTGCTGGGCCGG + Exonic
1057652632 9:96931809-96931831 GGGCGGCCTGTGTGTTGGGCCGG - Exonic
1058549026 9:106093523-106093545 TGGCTGCCTGTGGGCCGGGCTGG + Intergenic
1059234725 9:112751428-112751450 GGGAGGCGTGTGTTCAGGGCAGG + Intronic
1061500506 9:130998801-130998823 GGACCACGTGTGTCCCGGCCTGG - Intergenic
1062086924 9:134653813-134653835 GGGCTGGGGGTGTGCAGGGCCGG + Intronic
1062086928 9:134653829-134653851 GGGCCGGGTGTCTGTAGGGCTGG + Intronic
1062086982 9:134654065-134654087 GGGCTGGGTGTGTGTAGGGCTGG + Intronic
1062087090 9:134654524-134654546 GGGCTGGGTGTGTGTAGGGCTGG + Intronic
1062087094 9:134654540-134654562 GGGCTGGGTGTGTGTAGGGCTGG + Intronic
1062087098 9:134654556-134654578 GGGCTGGGTGTGTGTAGGGCTGG + Intronic
1062087161 9:134654839-134654861 GGGGCTCGTGTGTGTAGGGCTGG + Intronic
1062230494 9:135479534-135479556 GGGCCGCGTCCGAACCGGGCGGG + Intronic
1062537070 9:137025726-137025748 AGGCCGGGTGTGGGCGGGGCTGG - Intronic
1062556085 9:137114064-137114086 GGGGCACGCGGGTGCCGGGCGGG - Intronic
1062556102 9:137114105-137114127 GGGGCACGCGGGTGCCGGGCGGG - Intronic
1062556119 9:137114146-137114168 GGGGCACGCGGGTGCCGGGCGGG - Intronic
1062556136 9:137114187-137114209 GGGGCACGTGGGTGCCGGGCGGG - Intronic
1062556152 9:137114227-137114249 GGAGCACGTGGGTGCCGGGCGGG - Exonic
1187367151 X:18675140-18675162 GGGCCGCGACTGTGGCGGGCAGG - Intergenic
1188776556 X:34226766-34226788 TGGCTGCCTGTGGGCCGGGCAGG - Intergenic
1189323007 X:40097525-40097547 GGGCCGGGTGGGGGCGGGGCGGG + Intronic
1190745646 X:53320604-53320626 GGGTCGCGAGCGTGGCGGGCGGG - Exonic
1195838289 X:109144066-109144088 TGGCTGCCTGTGGGCCGGGCAGG + Intergenic
1198750320 X:139932237-139932259 GGGCCGCGAGTGAGGCGGGGCGG - Intronic
1200074450 X:153544202-153544224 GGGCCTCGTCTGGGCTGGGCTGG + Intronic
1200147631 X:153934834-153934856 GCGCCGCGTGGGCGCCGGGCCGG - Intronic