ID: 1034233246

View in Genome Browser
Species Human (GRCh38)
Location 7:149548873-149548895
Sequence TCATAAACACAGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 317}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034233246_1034233258 22 Left 1034233246 7:149548873-149548895 CCCTGCCCCTTCTGTGTTTATGA 0: 1
1: 0
2: 1
3: 38
4: 317
Right 1034233258 7:149548918-149548940 ACACCAGATGTGCATGTGGGGGG 0: 1
1: 0
2: 1
3: 16
4: 182
1034233246_1034233255 19 Left 1034233246 7:149548873-149548895 CCCTGCCCCTTCTGTGTTTATGA 0: 1
1: 0
2: 1
3: 38
4: 317
Right 1034233255 7:149548915-149548937 TAAACACCAGATGTGCATGTGGG 0: 1
1: 0
2: 1
3: 7
4: 191
1034233246_1034233254 18 Left 1034233246 7:149548873-149548895 CCCTGCCCCTTCTGTGTTTATGA 0: 1
1: 0
2: 1
3: 38
4: 317
Right 1034233254 7:149548914-149548936 ATAAACACCAGATGTGCATGTGG 0: 1
1: 0
2: 0
3: 17
4: 230
1034233246_1034233256 20 Left 1034233246 7:149548873-149548895 CCCTGCCCCTTCTGTGTTTATGA 0: 1
1: 0
2: 1
3: 38
4: 317
Right 1034233256 7:149548916-149548938 AAACACCAGATGTGCATGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 161
1034233246_1034233257 21 Left 1034233246 7:149548873-149548895 CCCTGCCCCTTCTGTGTTTATGA 0: 1
1: 0
2: 1
3: 38
4: 317
Right 1034233257 7:149548917-149548939 AACACCAGATGTGCATGTGGGGG 0: 1
1: 0
2: 3
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034233246 Original CRISPR TCATAAACACAGAAGGGGCA GGG (reversed) Intergenic
900720039 1:4170025-4170047 TCATAAATATGGAAGGGGCCTGG - Intergenic
901394980 1:8974550-8974572 ACAAAAACAGAGAAGGGGGACGG - Intronic
901403704 1:9031994-9032016 CCATGAACTCAGAAGGGGCGGGG + Intergenic
901845731 1:11980749-11980771 TGAAAAATAGAGAAGGGGCAGGG - Intronic
901918511 1:12519156-12519178 TCAAAAGCACAGAAAGGTCACGG + Intergenic
902127125 1:14224218-14224240 TCATAAAGGCCAAAGGGGCAGGG + Intergenic
902268442 1:15286002-15286024 TCATAGAAATAGAAGGGGAATGG + Intronic
902285143 1:15403431-15403453 TCAAATCCACAGAAGGGTCATGG - Intergenic
902947781 1:19854743-19854765 TCAGAAAGATAGAAGGCGCATGG + Intergenic
903391790 1:22969610-22969632 GCATAAAGACACAGGGGGCAGGG - Intergenic
903422040 1:23225064-23225086 TCAAAGACAGAGAAGAGGCATGG - Intergenic
905352975 1:37360273-37360295 TCATAAACAGAGAAGCAGCAAGG - Intergenic
906094878 1:43216085-43216107 TGATAAACACACAAGGCTCATGG + Intronic
908927887 1:69278721-69278743 TCATAGAAACAGAAGTGGGATGG - Intergenic
909377978 1:74961725-74961747 TAATAAACACAGAATGCACAGGG + Intergenic
909591220 1:77351522-77351544 ACAGAAAGACAGAAGGGGCCTGG - Intronic
909891270 1:81010171-81010193 TTAAAAAGACAGAAGGAGCAAGG + Intergenic
910254793 1:85237222-85237244 TAATGAAAACAGAAGGGGAAAGG + Intergenic
910340310 1:86179675-86179697 TCATAGAGACAGAAGTGGAATGG - Intergenic
911737586 1:101354602-101354624 TACAAAACACAGAGGGGGCAAGG - Intergenic
912261790 1:108118214-108118236 TCATGAACACAGCAAGAGCAAGG + Intergenic
912398951 1:109372621-109372643 ACAAAAACACAGAATGGGCCGGG + Intronic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
914016164 1:143820537-143820559 GCAGAAAGACAGAAGGAGCAGGG - Intergenic
914437462 1:147672365-147672387 CCATAGACAGAGCAGGGGCATGG - Intergenic
914654783 1:149729078-149729100 GCAGAAAGACAGAAGGAGCAGGG - Intergenic
915182708 1:154076963-154076985 TCATAAAAACAGAAAGGGAAGGG + Intronic
916991735 1:170251729-170251751 TCATTAACACAGAAGGTGGCAGG - Intergenic
917254525 1:173100038-173100060 AAATAAACACAGGAGGGGCCGGG - Intergenic
918125226 1:181577737-181577759 ACAGAGACACAGAAGGGTCAAGG - Intronic
918615061 1:186534633-186534655 TCAGAAACAAAAAAGGGGGAAGG - Intergenic
920337237 1:205253246-205253268 TACTAAAGAAAGAAGGGGCATGG + Intronic
920580609 1:207104005-207104027 TCATAAACACATAAGGGTTATGG - Intergenic
920650219 1:207832039-207832061 TCATAAACACAAGTGGGGCAGGG + Intergenic
921106384 1:211984144-211984166 TTAAAAACACTGAAGGGGCCAGG - Intronic
921811544 1:219520095-219520117 TGATAAACACAGAAAGGGAACGG - Intergenic
922330514 1:224571427-224571449 TCATAAAACCAGCAGGGGCCAGG + Intronic
922966884 1:229697871-229697893 TCATAAACCCAAAAAGGGCAGGG - Intergenic
923025742 1:230202532-230202554 TCATATGCACAGCAGGGGCCTGG - Intronic
923243764 1:232111020-232111042 TTATAAACACAGACGCAGCATGG - Intergenic
923755158 1:236785388-236785410 TCACCAACTCAGAAGGGGCAGGG - Intergenic
924376049 1:243410380-243410402 GAATACAGACAGAAGGGGCAGGG - Intronic
1062961694 10:1577270-1577292 TCATGCACACAGAAGGTGGATGG + Intronic
1063195580 10:3739429-3739451 TCATAGACACAATATGGGCATGG + Intergenic
1065773500 10:29099286-29099308 TCATAAACTCAGCAGGTCCATGG - Intergenic
1066115882 10:32239271-32239293 TCATAGAAACAGTAGGGGCCAGG - Intergenic
1067821726 10:49536905-49536927 ACAAAAAAACAGAAGGGGCCTGG + Intronic
1067921925 10:50467927-50467949 TGATAGAAACAGAAGGGGAAGGG + Intronic
1068851177 10:61742978-61743000 TCATATGCACAGCAGGGGAAAGG + Intronic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1070087012 10:73247294-73247316 TCACAAGCACTGAAGGGGCGTGG + Exonic
1070112795 10:73500745-73500767 GGAGAAACACAGAAGGGTCATGG + Exonic
1070155381 10:73831183-73831205 TGGAAAACAGAGAAGGGGCATGG + Intronic
1071290036 10:84182002-84182024 TCAAAAACAGTGAGGGGGCAAGG - Intronic
1072502828 10:96035623-96035645 TCATAGACACAAAAGTAGCAAGG - Intergenic
1072908059 10:99473350-99473372 TCATAAAAACAGGCCGGGCATGG - Intergenic
1076655342 10:132019891-132019913 GGATCAACTCAGAAGGGGCAGGG + Intergenic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1082931313 11:58609018-58609040 TAATAAACTCAGAACGGGAAAGG - Intronic
1083258859 11:61512489-61512511 TCTTAGACACAGAAGCAGCAGGG + Intergenic
1084629310 11:70335879-70335901 CCATACACACAAATGGGGCATGG - Intronic
1085617644 11:78013590-78013612 TAATAAACTCAGATGGGGAAGGG - Intergenic
1089376275 11:117996876-117996898 CCAAAAGTACAGAAGGGGCAGGG - Intronic
1089618954 11:119711593-119711615 TAAACAACACAGAAGGGGAAGGG + Intronic
1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG + Intergenic
1090648312 11:128784321-128784343 CCCTAAACACAAAAGGGCCAAGG - Intronic
1090977215 11:131688296-131688318 TCAGAAACCCAGGAGGGGCACGG - Intronic
1091612651 12:2024444-2024466 GCAACAACACAGAAGGGGCCTGG - Intronic
1093421487 12:18979353-18979375 TCTTAAACAGAGATGGGGAAGGG - Intergenic
1093630958 12:21408578-21408600 TCATCAACAGAGAAGGGGACTGG - Intronic
1093748550 12:22771946-22771968 TCACAAACACAGAAGGAACCTGG + Intergenic
1094019868 12:25902790-25902812 GCAAAAACAAAGCAGGGGCAAGG - Intergenic
1096921532 12:55091632-55091654 TGATAAAGAAAGAAGGGGCTGGG - Intergenic
1097266782 12:57750565-57750587 TCAAAAAAAAAGAATGGGCAAGG + Intronic
1099330830 12:81284414-81284436 TCATGCACACGGTAGGGGCAAGG - Intronic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099988252 12:89694472-89694494 TCAAATACATTGAAGGGGCATGG + Intronic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1100747196 12:97659473-97659495 GGAGGAACACAGAAGGGGCATGG - Intergenic
1101070797 12:101073634-101073656 TCACAGACACAAAAGGGACAGGG - Intronic
1101116177 12:101533722-101533744 TCAGAACCACCAAAGGGGCAGGG - Intergenic
1101662544 12:106778721-106778743 TCAAAAACACAGAAGAGACAGGG - Intronic
1102523655 12:113495143-113495165 AGATTAACCCAGAAGGGGCAAGG - Intergenic
1102985352 12:117273229-117273251 TCATAAGCACCGTGGGGGCAGGG + Intronic
1106405099 13:29466353-29466375 GCATAGACACAGAAGAAGCAAGG - Intronic
1106760517 13:32863007-32863029 TCAGAAACTAAGAAGAGGCAAGG + Intergenic
1107328429 13:39270668-39270690 AAATAAACATAGAAGGGGTATGG - Intergenic
1107483258 13:40802865-40802887 GCAAAAGCACAGATGGGGCAGGG - Intronic
1107583294 13:41815575-41815597 ACCAAAACCCAGAAGGGGCAAGG + Intronic
1107598470 13:41988305-41988327 CCATAACCACAGAAGGAGAATGG + Intergenic
1107825072 13:44321647-44321669 TCATAAACATAGAAGGGTGGGGG + Intergenic
1108500180 13:51063223-51063245 TCAAAAACACACCAGTGGCATGG + Intergenic
1108715686 13:53075718-53075740 TCATCACCATAGAGGGGGCAGGG - Intergenic
1111021294 13:82455973-82455995 TCAAAAAGACAAAAGAGGCATGG + Intergenic
1112768396 13:102771522-102771544 TCACACACACAGATGGGGAAAGG - Intronic
1112911948 13:104496378-104496400 TCATTAATAGAGAATGGGCATGG - Intergenic
1113247164 13:108410615-108410637 TCAGAAACACAGCACCGGCAGGG + Intergenic
1113308084 13:109099994-109100016 TCATAAACACAGAAGGCAACAGG + Intronic
1113510064 13:110846658-110846680 TCAGACAGACAGCAGGGGCAGGG + Intergenic
1113544534 13:111138016-111138038 TCAAAAACACAGCTGGGGCCAGG + Intronic
1114726509 14:24943267-24943289 TCAGAAAGGAAGAAGGGGCAGGG - Intronic
1116699540 14:48221917-48221939 TCATAATCACAGAAGTGGACTGG - Intergenic
1118082450 14:62376532-62376554 TCAGAAACAAAGAAGAGGCTGGG - Intergenic
1118183272 14:63515060-63515082 TCAGAAATACAGAAGTGACATGG - Intronic
1119553088 14:75530807-75530829 TTAAAAACACAGAAGGGGCTGGG - Intronic
1119590071 14:75878341-75878363 GAATAAAGACAGAAGGAGCATGG - Intronic
1120379584 14:83758768-83758790 TCAAAAACAAACAATGGGCAAGG - Intergenic
1121171260 14:91856326-91856348 TAAAAAATACAGAAAGGGCATGG + Intronic
1121769893 14:96524521-96524543 TCAAAAAAAGAGAAGGGGAAGGG - Intronic
1124076601 15:26451765-26451787 TCACAAGCACTGAAGTGGCAAGG - Intergenic
1124820280 15:33038315-33038337 TTTTAAACACAGAAGATGCAGGG - Intronic
1125789886 15:42356988-42357010 TATCAAACACAGAAAGGGCAAGG - Intergenic
1126192972 15:45898282-45898304 TCAATAACACAGAAAGGGTATGG - Intergenic
1127842812 15:62845588-62845610 TCCTACACACAGCAGGGGCTGGG - Intergenic
1131100448 15:89684892-89684914 TTATAATCTCAGAAGGGGCTGGG + Intronic
1131913896 15:97240102-97240124 TTATCAAAACAGAAGGGACAGGG - Intergenic
1132305210 15:100807276-100807298 CCATCAACTCAGAAGGGGCAGGG - Intergenic
1133648026 16:7782657-7782679 GAATAAACAAAGAATGGGCAAGG - Intergenic
1135907671 16:26528133-26528155 GCATAAATACAGAGGGCGCAGGG - Intergenic
1136407673 16:30058024-30058046 TCAAATAGACAGAAGGGGTAGGG - Intronic
1137634548 16:49974415-49974437 TCAAAAACAGAGGAGGGGCCGGG + Intergenic
1137723904 16:50644444-50644466 TCATAAAGACAGATGGGAAAAGG + Intergenic
1138354487 16:56366672-56366694 GCACAAACACAGAAAGGCCAAGG + Intronic
1139482783 16:67239904-67239926 TAATAAACACAGATGAGGAAGGG + Intronic
1140788691 16:78368578-78368600 TCATAAATATTGAAGAGGCAGGG + Intronic
1141140796 16:81495638-81495660 ACATAAAAAGAGAAGGGGCCTGG - Intronic
1141616981 16:85215389-85215411 TCAGACACTCAGAAGGGGAAGGG + Intergenic
1142891138 17:2943852-2943874 TCAAAACCACAGAAGAGGCCAGG + Intronic
1143393877 17:6576635-6576657 TCAGAAACACAGAAGCGTGATGG + Intergenic
1143440278 17:6966550-6966572 TCATTATCACAGAAGGGGACAGG + Intronic
1143739263 17:8940854-8940876 TCAAAAACACAGCAGGGGCCAGG - Intronic
1146792347 17:35759261-35759283 GCATAAACACAAAAGGCTCAAGG - Intronic
1146922192 17:36721225-36721247 TCATAAAAACAAAACGGGCCGGG - Intergenic
1146970486 17:37067899-37067921 TCATAAACACAGTCTGGGCCTGG + Intergenic
1147543496 17:41380503-41380525 ACAAAGACACAGAAGTGGCAGGG - Intronic
1147961674 17:44171226-44171248 TCCTAAACAGAGATGAGGCAGGG + Intronic
1148002355 17:44397330-44397352 TTAGAAACACAGAAGAGGGAGGG + Intronic
1149160523 17:53687267-53687289 CCACCAACTCAGAAGGGGCAGGG + Intergenic
1149442863 17:56689972-56689994 ACATAGACACAGAGGAGGCATGG + Intergenic
1149627499 17:58090203-58090225 ACATATACACAGAAGAGTCAAGG - Exonic
1151418320 17:73981246-73981268 TAAGAAACACAGAAGGAGGAAGG + Intergenic
1152387740 17:79985209-79985231 ACACAGACACAGGAGGGGCAGGG - Intronic
1153267274 18:3283886-3283908 TCACAAACAAGGGAGGGGCAAGG - Intergenic
1155184071 18:23372229-23372251 ACATAAACAAATAAGGGGCTGGG - Intronic
1156866288 18:41892337-41892359 TCATATACATTGGAGGGGCAGGG - Intergenic
1157488875 18:48108430-48108452 TCAAAAACAAGGTAGGGGCAGGG - Intronic
1157822574 18:50784496-50784518 ACACACACACAGAAGGGGCATGG + Intergenic
1158199893 18:54928434-54928456 TAATAAACACAGAAGCATCAGGG + Intronic
1158290161 18:55931974-55931996 GCATATACACAGAATGGTCAGGG + Intergenic
1159891912 18:73961147-73961169 TGATAAATACTGCAGGGGCAAGG + Intergenic
1159894262 18:73981613-73981635 TGATAAATACTGCAGGGGCAAGG + Intergenic
1160187581 18:76687594-76687616 ACAGGCACACAGAAGGGGCAGGG + Intergenic
1161005187 19:1932116-1932138 TTTGAAACACAGAAGGGGCAAGG + Intergenic
1161483834 19:4524253-4524275 TCATAAACACACAATGGGGCCGG + Intronic
1162125996 19:8499812-8499834 TCAAACACACAGAAGGGGCATGG + Intronic
1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG + Intergenic
1163959879 19:20679157-20679179 TAATAAAAACAGAATGGGCTGGG - Intronic
1163985258 19:20940691-20940713 TCATAAAAACAGAAAGTGGAAGG - Intronic
1163995027 19:21036969-21036991 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164008321 19:21172948-21172970 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164068289 19:21741208-21741230 TCATAAAAACAGAAAGTGGAAGG + Intronic
1164239382 19:23370344-23370366 TCATAAAAACAGAAAGTGGAAGG + Intronic
1164285602 19:23813392-23813414 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164317903 19:24110719-24110741 TCATAAAAACAGAAGGTGGAAGG - Intronic
1164566593 19:29330232-29330254 CCATAAACATGGAAGGGGGAAGG - Intergenic
1164659557 19:29950846-29950868 TCATAAAGACAGAAGGTGGCGGG - Intronic
1165022496 19:32935987-32936009 CCACCAACTCAGAAGGGGCAGGG - Intronic
1165365604 19:35363058-35363080 GCAGGAACACAGAAGGGCCAGGG - Intergenic
1165503786 19:36211496-36211518 TAATAAACATAGAAGTGGCCGGG + Intronic
1166695555 19:44849454-44849476 TGATGAACACAGAAGGGACAGGG + Intronic
1166752499 19:45171004-45171026 TCTTAAAAACAGAAGGGGCTGGG + Intronic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
925238404 2:2299145-2299167 TAATAAACACAGAGTTGGCAGGG - Intronic
927080939 2:19630113-19630135 TCATAAGCACAGAACTGGGAAGG - Intergenic
927714972 2:25345949-25345971 TCATAGAGACAGAAGTGGAATGG + Intergenic
928618531 2:33064777-33064799 GCAGAAACACAGAAGGCACATGG + Intronic
928677784 2:33666749-33666771 TCATAGGCACAGAATGGGGAGGG - Intergenic
929396941 2:41534097-41534119 ACATAGGCCCAGAAGGGGCAGGG + Intergenic
929451011 2:42037128-42037150 TCCAAAACACAGGAGGGGAAGGG + Intergenic
929762201 2:44815646-44815668 TCATCAACGCACAAGTGGCAAGG - Intergenic
930061392 2:47292090-47292112 TCAAAAAAAGAGAAGGGGCCGGG + Intergenic
930655161 2:54000685-54000707 TGATAACCCCAGCAGGGGCAAGG + Intronic
931115182 2:59158611-59158633 TCATAAACACACACGGGACTTGG - Intergenic
931458422 2:62430511-62430533 TCATAAAGACAGAAGCAGGATGG + Intergenic
932230493 2:70080219-70080241 AAAAAAAAACAGAAGGGGCAGGG - Intergenic
932416404 2:71576164-71576186 TCAATCACAGAGAAGGGGCATGG - Intronic
933233380 2:79835924-79835946 TCAAAAACAAAGAAAGGGCTGGG - Intronic
933876528 2:86625547-86625569 TCAAAAATACAGAATAGGCATGG + Intronic
936868604 2:117107302-117107324 TTATAAGCACAGAATGGGGATGG - Intergenic
937536681 2:122897248-122897270 TGCAAAACACAGAAGGGTCATGG + Intergenic
939560867 2:143730013-143730035 TTAGAAAAACAGAAGAGGCAAGG + Intronic
940234268 2:151492713-151492735 TCATTTTCAAAGAAGGGGCACGG + Intronic
945719145 2:213397014-213397036 TCATTAGCACAGAAGGTGAAGGG - Intronic
946746248 2:222848541-222848563 TCAGAAAGACAGACCGGGCACGG - Intergenic
947611522 2:231527730-231527752 ACCAAAACACAGAAAGGGCAGGG - Intronic
947726331 2:232403081-232403103 TCATAGAGACAGAAGTGGAATGG - Intergenic
948303976 2:236932883-236932905 CAATAAACACAGGAGGGGGAAGG + Intergenic
948737484 2:240018463-240018485 TCATAAACACAGTAAGTGCAAGG + Intronic
1169163148 20:3399776-3399798 ACACAAACACAGAAGAGGCCTGG + Intronic
1170467379 20:16635163-16635185 CCATAAACACATAAAGGGCAAGG - Intergenic
1170558430 20:17534614-17534636 TAATAAAAACAGAAGGGGGATGG + Intronic
1171286809 20:23946383-23946405 TCATAACAACAGAGGGGCCAAGG - Intergenic
1171567967 20:26212460-26212482 TCATAAACCCAAAAGGTGAACGG + Intergenic
1172566585 20:35935357-35935379 ACATAAAAAAAGAAAGGGCAAGG - Intronic
1172779937 20:37430539-37430561 TCAGACACACAGCAGGGACATGG - Intergenic
1172884878 20:38224211-38224233 TGATAAACACAGTATGGGCTGGG - Intronic
1175064300 20:56272357-56272379 CCACCAACTCAGAAGGGGCAGGG - Intergenic
1175185784 20:57178925-57178947 TCATGAGCACAGAAGGGACAAGG + Intronic
1175668522 20:60880874-60880896 ATATAAACACAGAAGGGCAAAGG + Intergenic
1176161042 20:63648956-63648978 TCATCAGGAAAGAAGGGGCACGG + Intronic
1176873138 21:14099970-14099992 TCATGAAAACTGATGGGGCAGGG + Intergenic
1177396196 21:20538518-20538540 GCACTAACTCAGAAGGGGCAGGG + Intergenic
1177736096 21:25092431-25092453 CCATCAACTGAGAAGGGGCAGGG + Intergenic
1179632670 21:42688424-42688446 TTCTAAGCACAGAAGGGCCAGGG + Intronic
1179959889 21:44762234-44762256 TGACAAACACAGAAGGGGACTGG + Intergenic
1180197035 21:46203123-46203145 TCAGACAGCCAGAAGGGGCAGGG + Intronic
1181140912 22:20804174-20804196 TCCTAAAGACAGAACCGGCAGGG + Intronic
1181615349 22:24050393-24050415 CCAAAAATACAGAAAGGGCAGGG - Intronic
1183168983 22:36170708-36170730 TCATAAAGACAGCATGGGCCGGG + Intergenic
1183367808 22:37416570-37416592 TCATGACCACAGAAGTGGGAGGG + Intronic
1183672005 22:39278471-39278493 TCATGCAAACAGAATGGGCAGGG - Intergenic
1183867462 22:40715155-40715177 TCATAGAAACAGAAAGGGGAAGG + Intergenic
949530762 3:4952968-4952990 ACATAAACACAGAAACGGCGTGG - Intergenic
950963668 3:17131082-17131104 TCAAAAACACAGAAGAGCCAAGG + Intergenic
952269471 3:31817450-31817472 CCATCAACTCAGAAGGGGCAGGG + Intronic
952497619 3:33929609-33929631 TCATATTCGCATAAGGGGCATGG - Intergenic
952691059 3:36206719-36206741 TCTTAAACACAGAATGGGGTAGG + Intergenic
954594707 3:51814506-51814528 TCCAACACACAGAAGGGGCTTGG - Intergenic
956921263 3:73931962-73931984 TCATGAACACAGGATGAGCAGGG - Intergenic
957615418 3:82519959-82519981 TCAGAAACAAAGAAGGGAAAAGG + Intergenic
957750757 3:84412123-84412145 TCATAAAGACACAATTGGCAAGG - Intergenic
958272036 3:91512910-91512932 ACAAAAACATAGAAAGGGCAGGG + Intergenic
958956122 3:100467324-100467346 TCATAGTAACAGAAGGGCCAAGG - Intergenic
959120410 3:102225478-102225500 TCATCAGCTCAGAAGGGGGAAGG + Intronic
959389073 3:105751054-105751076 TAATAAACACAGAAGGCAAAGGG + Intronic
959398922 3:105875405-105875427 TAATAGAAACAGAAGAGGCAAGG + Intergenic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
963260456 3:143186817-143186839 TCATCAACAGAGAAGGAGGATGG + Intergenic
963882264 3:150541506-150541528 ACAGAAACAAAGAAGGGACATGG - Intergenic
964063223 3:152551196-152551218 ACACACACACACAAGGGGCAGGG + Intergenic
964338754 3:155685862-155685884 TCACAAACACACAAGAGGCTTGG + Intronic
965005561 3:163018829-163018851 TCTCCAACTCAGAAGGGGCAGGG - Intergenic
968920245 4:3518742-3518764 TCAGGAACACAGCAGGGGCAGGG - Intronic
970042656 4:11813223-11813245 TCAAAAACACTGAGGGGACATGG - Intergenic
970289221 4:14553272-14553294 TCATAAACAGGGAACGGTCAGGG + Intergenic
970387188 4:15567511-15567533 TCTTAAAAACTTAAGGGGCAAGG - Intronic
970897418 4:21119922-21119944 TTAGAAACACAGAAGAGGAAAGG + Intronic
971784437 4:31082762-31082784 TCAGAAACTCAGAAGAGGGAGGG + Intronic
972188166 4:36557663-36557685 TCATAGAAACAGAAAAGGCATGG - Intergenic
972203741 4:36747360-36747382 ACCTTAACTCAGAAGGGGCAGGG - Intergenic
973333411 4:48932340-48932362 GTATAAACACAGATTGGGCATGG + Intergenic
975310076 4:72893976-72893998 TCAGCTACAGAGAAGGGGCAAGG + Intergenic
975496113 4:75037638-75037660 TCATAAACCAAGAAGGGCCCTGG - Intronic
978499470 4:109393629-109393651 TTAAAAACACAGGAGGGGCCGGG - Intergenic
979172246 4:117615825-117615847 TAATAAGCACAGAAAAGGCATGG + Intergenic
979312777 4:119223600-119223622 TCACAAACACAGAAGTACCAGGG - Intronic
979829176 4:125279497-125279519 TCTTATACACAGAAGGGAGATGG + Intergenic
980072589 4:128259674-128259696 TCATATACATAGAAGGGGATTGG + Intergenic
980204587 4:129701243-129701265 TCATATACTCAGAAGGGCCAAGG - Intergenic
980424763 4:132613670-132613692 TTAGAAACACAGAGGGGGAAAGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
982430691 4:155318620-155318642 TAATAAAGACAGAAGGGGCCAGG - Intergenic
983687088 4:170423088-170423110 TAATAAATACAGACAGGGCACGG - Intergenic
984194529 4:176642635-176642657 TCATAACCACAGCAGGGGAGAGG - Intergenic
984873124 4:184344976-184344998 TCATAAAGACAGAAAGTGAAGGG + Intergenic
985127110 4:186705622-186705644 TGCTAAACACAGAAGATGCAGGG + Intronic
985781274 5:1873152-1873174 TCGCAAAGACAGAAGGAGCAAGG + Intergenic
986461518 5:7977518-7977540 TCATAAACATAGATGCGGAAAGG + Intergenic
986548207 5:8923231-8923253 TCATAAACACACAAGAAGCACGG + Intergenic
986656992 5:10023234-10023256 ACACAAACACTGAAGGGGAAAGG + Intergenic
987332535 5:16869891-16869913 TAATAAAAACAGAAGGAGAAAGG + Intronic
987416601 5:17669179-17669201 ACTAAAACACAGAAGGTGCAGGG + Intergenic
991564378 5:67989640-67989662 GCATAAACACAGACAGGGAAAGG + Intergenic
994834963 5:104838904-104838926 TCATACACACAGAATGGGGCAGG - Intergenic
995989025 5:118213270-118213292 TCAAAAACACAGAATGGGCCAGG + Intergenic
998355132 5:141529069-141529091 TCAAAAACAGACAAGCGGCAAGG + Intronic
998886667 5:146701689-146701711 TCACAAAAAAAGAAGGGGCACGG - Intronic
1001523317 5:172411317-172411339 TGAAAAACACAGCAGTGGCAGGG - Intronic
1004278638 6:14259683-14259705 ACATAACCAAAGAAGGGGCTGGG - Intergenic
1004285491 6:14317162-14317184 TAATAAGCACAGAAGAGGAAGGG + Intergenic
1004940865 6:20554899-20554921 TCATAAACACTGAAGAGTAATGG + Intronic
1007173859 6:39883241-39883263 TCCTACACAGAGATGGGGCAAGG + Intronic
1007740745 6:44008170-44008192 TTATAAACAGAGAAGTAGCAGGG + Intergenic
1008344085 6:50404863-50404885 TCATAAACACTCCAGGGGGAGGG - Intergenic
1008983069 6:57508230-57508252 ACAAAAACACAGAAAGGGCAGGG - Intronic
1009171129 6:60401095-60401117 ACAAAAACATAGAAAGGGCAGGG - Intergenic
1009757650 6:67960125-67960147 TCATAAATATAGAAGTGGGAAGG + Intergenic
1010469911 6:76215192-76215214 ACCTAAACACAGAAAAGGCATGG + Intergenic
1010536210 6:77034407-77034429 TGATAAACACAGAAATAGCAAGG + Intergenic
1010800507 6:80168845-80168867 TCAGAAAGAAAGACGGGGCATGG - Intronic
1011381834 6:86750307-86750329 TTATAAACTCAGTGGGGGCAGGG + Intergenic
1011987938 6:93473850-93473872 TCAAAAATACAGAAAGGGCCGGG + Intergenic
1017980247 6:159394839-159394861 ATATAAACTCAGGAGGGGCAAGG + Intergenic
1019350986 7:553868-553890 TCATAAACACGGCAGAGGCCTGG - Intronic
1021073750 7:16274893-16274915 TCATAAAAACAGAAAAAGCAAGG + Intronic
1022094903 7:27133124-27133146 TCATAAACACAAACGGAGCCAGG + Intronic
1022564388 7:31383197-31383219 TCAGAAGCACAGAAGGGTCACGG + Intergenic
1022658615 7:32345070-32345092 TGATCATAACAGAAGGGGCATGG - Intergenic
1023054282 7:36279116-36279138 TGACAAACAAAGCAGGGGCAGGG - Intronic
1024493289 7:50011754-50011776 TCAAAAAGAAAGAAGGGGCCAGG + Intronic
1027058189 7:75064803-75064825 GCAGAAACTCACAAGGGGCATGG + Intronic
1027704742 7:81515134-81515156 TCATAAACATAGAAAGTGCCTGG - Intergenic
1029454790 7:100663769-100663791 TAATAAACAAAGAAGGGCAATGG - Intergenic
1032270912 7:130404590-130404612 TCATAAACAACGCAGGAGCAGGG - Exonic
1032430997 7:131861492-131861514 TCACATAGACAGAAGGGGAAAGG - Intergenic
1033330440 7:140412833-140412855 ACATAAACATAGATGGGGCGTGG + Intronic
1034233246 7:149548873-149548895 TCATAAACACAGAAGGGGCAGGG - Intergenic
1037400149 8:18487558-18487580 TCATCAAAACAGAAGGACCATGG - Intergenic
1038974802 8:32683159-32683181 TCATAAATGCAGAAATGGCAAGG - Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1039988253 8:42466107-42466129 TCCTCAACACAGAGGGGACAGGG + Intronic
1040614302 8:49018985-49019007 TCAAAAACAGAGATGGGGCTGGG - Intergenic
1041206688 8:55506539-55506561 TCTTAAACAAAGATGGTGCAAGG - Intronic
1041214077 8:55582628-55582650 TCAAAAACACTGAAGCTGCAAGG + Intergenic
1041952345 8:63517671-63517693 TCCAAAACACAGAAGTGGCAGGG - Intergenic
1043639880 8:82438695-82438717 TCAAAAGCACAAAAGGGGCCAGG - Intergenic
1044686123 8:94827414-94827436 TCATAAACTCAGAAGGCGTTGGG + Intronic
1045615321 8:103902367-103902389 TCATAAACAAGGTAGGGGGATGG - Intronic
1046156090 8:110291792-110291814 TCAGAAACAAAGATGGGGCCAGG - Intergenic
1047839811 8:128738999-128739021 TCATGCACAAAGAAGGGGAAGGG + Intergenic
1049458054 8:142704304-142704326 TCACAAAGACTGAAGTGGCATGG - Exonic
1052786531 9:32833287-32833309 TCAGAAACTCTGAAGGGGTATGG + Intergenic
1054703641 9:68439280-68439302 TCTTGAACACAGGAGGGACAAGG + Intronic
1054960599 9:70964222-70964244 TCATAAACTCCAAAAGGGCAAGG + Intronic
1056072517 9:83003226-83003248 ACACACACCCAGAAGGGGCATGG + Intronic
1056689033 9:88790244-88790266 TGAGAGACAGAGAAGGGGCAAGG + Intergenic
1056819924 9:89832831-89832853 TTAGAAACTCAGAAGGGGAAGGG + Intergenic
1057548362 9:96034681-96034703 ACCCAAACTCAGAAGGGGCAGGG - Intergenic
1059464274 9:114457521-114457543 TAATAAACATAGAAGGAACATGG + Intronic
1059496811 9:114717023-114717045 TCAAAAGTACAGAAGGGGCTAGG - Intergenic
1060474577 9:123977040-123977062 TCATAAACTCAAAAAGGCCAGGG - Intergenic
1060476785 9:123993083-123993105 TCATAAACTCAAAAAGGCCAGGG + Intergenic
1061934434 9:133849525-133849547 ACACAAACACAGCAGGGACATGG - Intronic
1061965493 9:134011733-134011755 ACATAAACATATAAAGGGCAGGG + Intergenic
1062202152 9:135309268-135309290 TCCTAGAAACAGAAGGGACAAGG - Intergenic
1186120563 X:6356602-6356624 TCAGAAACAAAGAAGGGGAAGGG + Intergenic
1186536160 X:10350840-10350862 TCAAAAACCCAGAAAGGGAAAGG - Intergenic
1187742515 X:22371724-22371746 TCAGAAACACAGCAGCGCCATGG + Intergenic
1187998722 X:24957777-24957799 TTTTAAGCAGAGAAGGGGCATGG + Intronic
1188872908 X:35396512-35396534 TTATAAACAAAGTAGGGGTAAGG - Intergenic
1188951956 X:36387429-36387451 TCAAGAAGACATAAGGGGCAAGG + Intergenic
1189949058 X:46210008-46210030 ACATAACCACAGAATGTGCAAGG + Intergenic
1191682994 X:63860262-63860284 TCATAAGGACAGAAGGCCCAAGG - Intergenic
1194196886 X:90905011-90905033 TCTTGATCACAGAAGGGGCAAGG + Intergenic
1194380138 X:93181212-93181234 ACCTCAACTCAGAAGGGGCAGGG - Intergenic
1194876744 X:99199124-99199146 TCAAAAACACAAAATGGGCCAGG - Intergenic
1195269156 X:103214206-103214228 TCTTAAACAAAAAAGGGGCCGGG + Intergenic
1196144364 X:112300773-112300795 CCATAAACACAGTAGGAGCAGGG - Intergenic
1196324480 X:114386390-114386412 TCATAGACACAGAAGTAGAATGG - Intergenic
1198111017 X:133502638-133502660 TGAGAAAGACAGAAGGGGCCAGG - Intergenic
1198154394 X:133944558-133944580 ACATACACACAGAAAGGGAAAGG + Intronic
1198875197 X:141217208-141217230 TAAGAAACACAGAAGGGGCCGGG + Intergenic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic
1199745514 X:150769849-150769871 TGATGACCACAGAAGGGGGAGGG + Intronic
1199866433 X:151853958-151853980 CCATAAAGACAAAAGTGGCAGGG - Intergenic
1200542735 Y:4479217-4479239 TCTTGATCACAGAAGGGGCAAGG + Intergenic
1201241902 Y:11965481-11965503 CCATAAATACAGATGGGGTATGG + Intergenic