ID: 1034235980

View in Genome Browser
Species Human (GRCh38)
Location 7:149569860-149569882
Sequence TCTTTCTTCCCCTGAGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 3, 1: 3, 2: 3, 3: 50, 4: 377}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034235980_1034235985 14 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235985 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
1034235980_1034235989 18 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235989 7:149569901-149569923 CCAGCCACTCCCTAGCGGGAGGG No data
1034235980_1034235987 17 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235987 7:149569900-149569922 GCCAGCCACTCCCTAGCGGGAGG No data
1034235980_1034235983 13 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235983 7:149569896-149569918 TCCCGCCAGCCACTCCCTAGCGG No data
1034235980_1034235992 23 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235992 7:149569906-149569928 CACTCCCTAGCGGGAGGGGAAGG No data
1034235980_1034235995 30 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235995 7:149569913-149569935 TAGCGGGAGGGGAAGGAGAGAGG No data
1034235980_1034235990 19 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235990 7:149569902-149569924 CAGCCACTCCCTAGCGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034235980 Original CRISPR TCTTTCTTCCCCTGAGAAGA CGG (reversed) Intergenic
900516835 1:3086148-3086170 TCTGTCCTGCCCTGAGAGGAGGG - Intronic
900627148 1:3613587-3613609 TCCTTCTTCCTCTGATAAGCTGG - Intergenic
901156118 1:7140324-7140346 TTTTTTTTCCCCTGAGAAAGTGG + Intronic
901260052 1:7864694-7864716 TCTCCTTTCCCCTAAGAAGAGGG + Intergenic
901946952 1:12711897-12711919 CCTTTCTTCCCCTGAAAAGAGGG + Intergenic
902906626 1:19563148-19563170 TGTGTCTTCCCCTGTGAAGCTGG + Intergenic
903304559 1:22403565-22403587 TCTGACTTCCCCTTAGAAGGAGG + Intergenic
903419676 1:23209683-23209705 ACTTTCCTCCCCTGGGAAGTGGG - Intergenic
903908210 1:26701715-26701737 TCTTTCTTCCCCTGGACTGAAGG + Intronic
904311477 1:29632424-29632446 TCTGGATTCCCCTGTGAAGATGG + Intergenic
904571639 1:31470579-31470601 TCTTTCTTCCCCTGAGAAGAGGG + Intergenic
905094195 1:35455222-35455244 TCTTTCTTCTCTTGAAAAGCTGG + Intronic
905349300 1:37333555-37333577 TCTTTCCTCCCCTGTGAAGTGGG + Intergenic
905530539 1:38675278-38675300 GCTTCCTTCCTCTGAGATGAAGG - Intergenic
905718866 1:40178693-40178715 TTTTTTTTCCCCAGAGATGAGGG + Intronic
906838855 1:49113836-49113858 TTTTTTTTTCCCTGAGAAGTAGG + Intronic
908392685 1:63697963-63697985 TATTTCTTTCCCTGAGAGGAAGG - Intergenic
908433140 1:64078651-64078673 TCTTTCTTCCAATCAGAGGAGGG - Intronic
912948320 1:114103270-114103292 TCATTCTTTCTCTTAGAAGAGGG - Intronic
914881324 1:151549146-151549168 TCCTTTTTCCCTAGAGAAGAAGG + Intronic
917077499 1:171220594-171220616 CTTTTCTTTCCCGGAGAAGAGGG - Intergenic
917439066 1:175050586-175050608 GCTTTCAACCCCTGAGATGAGGG - Intergenic
917537901 1:175887788-175887810 TCTTTCTTCCACTGAGCCAAAGG - Intergenic
917837381 1:178952212-178952234 GCTTCCTTCCCCTGACAGGAAGG - Intergenic
918202162 1:182277751-182277773 TCTCTCTTCCCCTGAAAGAATGG - Intergenic
919043231 1:192419581-192419603 TCATTCATACCCTGAGAAAAGGG - Intergenic
919557840 1:199083056-199083078 TCTCCTTTCCCCTGGGAAGAGGG - Intergenic
919774502 1:201185332-201185354 TGTTTCTGCACCTGAGAAAATGG + Intergenic
919814976 1:201431493-201431515 TCTTTCTTGCACAGAGAGGAGGG - Intergenic
919885322 1:201929591-201929613 TCTTTCTTCATTTGAGAAGTTGG + Intronic
920629424 1:207637175-207637197 TCTTTCTACCCTTGGGAATAGGG - Intronic
921198965 1:212786273-212786295 TATTTCTTGCCCTCAAAAGAAGG - Intronic
921793710 1:219318919-219318941 TTTTTCTTTCCGGGAGAAGATGG + Intergenic
921933308 1:220773162-220773184 TCTCCCTTCCCCTGAGATCAGGG - Intronic
921948186 1:220902996-220903018 TCTTTCTAGTCCTGAGATGATGG + Intergenic
922180606 1:223230112-223230134 TTTTTCTTCCCCTAACATGATGG - Intronic
922239672 1:223747448-223747470 TCTCCCTTCCCCTAAGAGGAAGG - Intronic
922388862 1:225117123-225117145 TATCTCTTCCTCTGAAAAGAAGG + Intronic
922450880 1:225736342-225736364 CCTTTCTTGTCCTGGGAAGAGGG - Intergenic
922579085 1:226683744-226683766 CCTTTCTTCATCTGAGAAAATGG + Intronic
923001673 1:230011370-230011392 TCTCACTTGCCCTAAGAAGATGG - Intergenic
923063597 1:230498534-230498556 CCTTTCTTTCCCTGAGAAGAGGG - Intergenic
923958241 1:239046917-239046939 TCTTTCTTCTCCTGGGTATATGG + Intergenic
924027700 1:239853106-239853128 TCTTTCTTTCTCTTAGTAGAGGG + Intronic
924244822 1:242073934-242073956 TCTTTCTTCACCTGAAACAAAGG - Intergenic
924253900 1:242163146-242163168 TCTTTCTTTTCTTGAGACGACGG + Intronic
924827869 1:247560854-247560876 TGTTTTTTCCCCTGTGAAGTCGG + Intronic
1063108555 10:3015222-3015244 TTCTTCTTCCCCTGGGAAAATGG - Intergenic
1063371283 10:5524614-5524636 CCTTTCTTCCCTTGAGTGGAGGG - Exonic
1064034286 10:11902692-11902714 GCTTTCTTCCCTTGAGCAGTGGG + Intergenic
1064085514 10:12343273-12343295 TTTTTTTTTCCCTGAGAAAATGG + Intergenic
1064176469 10:13079729-13079751 TCTTTCTTCCCCTGAGAAGAGGG - Intronic
1067197730 10:44136939-44136961 TGTTTCTTACCCTGAGAACTGGG - Intergenic
1068774705 10:60857326-60857348 CCTTTGGGCCCCTGAGAAGATGG + Intergenic
1070630976 10:78084475-78084497 CCTTTCTGCCCATGAGAAAATGG + Intergenic
1070992020 10:80740951-80740973 TCATTCTTCCCCTGAAAATAGGG - Intergenic
1071761367 10:88611194-88611216 TCCTTCTTCCCCTGGGAATGGGG - Intergenic
1072519529 10:96218838-96218860 TCTTTCTTCACCTCTGAAGCTGG + Intronic
1072703951 10:97666476-97666498 TCTTTGATCTCCTGAGAAAATGG - Exonic
1073738962 10:106384262-106384284 TCCTTCTTCCCCAGAGAAGTAGG + Intergenic
1074668698 10:115761911-115761933 ACTTTCCTCCCTTAAGAAGATGG + Intronic
1075320907 10:121491175-121491197 TCTGGCTTTCGCTGAGAAGATGG - Intronic
1076133877 10:128031378-128031400 GCTGTCTCCCACTGAGAAGAGGG - Intronic
1076262539 10:129079108-129079130 TCTTTCTCCACCTGAGATGGAGG + Intergenic
1076724681 10:132407838-132407860 TCCTCCTACCCCTCAGAAGATGG - Intronic
1076794930 10:132793805-132793827 TCTTTGGACCCCAGAGAAGAGGG - Intergenic
1077398185 11:2336939-2336961 TCTTTCTTCCCCCGAGAAGAAGG - Intergenic
1078097935 11:8311850-8311872 TCTTTCTTCCTTGGAGAAGTGGG - Intergenic
1078800771 11:14643060-14643082 TAGTTCTTCGCCTGTGAAGATGG + Intronic
1078826019 11:14930942-14930964 TGTTTCTTCACCTGAGAAGCTGG - Intronic
1078826082 11:14931426-14931448 TGTTTCTTCACCTGAGAAGCTGG - Intronic
1079015082 11:16862004-16862026 TGTCTCTTTCTCTGAGAAGAGGG - Intronic
1080847661 11:36040187-36040209 TCTTTCTTGCCCTTCGAAAAGGG - Intronic
1081384560 11:42456388-42456410 CCATCTTTCCCCTGAGAAGAAGG + Intergenic
1081701633 11:45156165-45156187 AGTTCCTTCCCCTGAGATGATGG + Intronic
1082933171 11:58630172-58630194 TCATCCTTCCCCTGATATGATGG + Intergenic
1082966485 11:58971350-58971372 TTTTTCTTCCCCTTAAAAGAGGG + Intronic
1083993775 11:66262110-66262132 TCTTCCTTCCCAGGAGGAGAAGG + Exonic
1085034314 11:73291041-73291063 TCCTTGAACCCCTGAGAAGAGGG + Intronic
1086061936 11:82708717-82708739 TTTCTCTTCCTCTGAGGAGAAGG - Intergenic
1086073573 11:82825596-82825618 TCTTCCCTCCCTCGAGAAGACGG - Intronic
1086574804 11:88327671-88327693 TCTGTCTTCCACAGAGAAGGTGG - Intronic
1088987375 11:114921480-114921502 TCTTTCTTACCCACAGAAGTAGG - Intergenic
1090645626 11:128764835-128764857 TCTTTCTCTCCCTGAGCAGTGGG + Intronic
1092167587 12:6352415-6352437 GCTTACTTCCCCGGAGAAGAGGG - Intronic
1092436709 12:8453373-8453395 TTTTTCTTCCCCGGAGGAGTGGG + Intergenic
1092756589 12:11769326-11769348 TTTTTCTTCCCTGGAGAATATGG + Intronic
1093128733 12:15363269-15363291 TCTTTTGTCCCTGGAGAAGATGG - Intronic
1093221886 12:16431521-16431543 TGTTTCATGCCCTAAGAAGAGGG + Intronic
1094209171 12:27872578-27872600 CTTTTCTTCCCCTAAGAACAGGG - Intergenic
1094741882 12:33299034-33299056 ACATTCTTCTCCTGAGAACATGG + Intergenic
1096442126 12:51651841-51651863 TCTTTCTTCCCTGGAGAAATTGG - Intronic
1096784327 12:54008614-54008636 TCTCTCTCTCTCTGAGAAGAAGG + Intronic
1097144195 12:56928814-56928836 TCTTTCTTTCCCTGAGCTGAGGG - Intronic
1098090885 12:66899826-66899848 TCTTTGTTCTCCTGTGAATATGG - Intergenic
1100163457 12:91889366-91889388 TCTATCTCTCCCTGAGAATAGGG - Intergenic
1100551736 12:95652418-95652440 TGTTTCTTCCTCTGAGAAATGGG + Intergenic
1100803720 12:98259644-98259666 TCAATCTTCCCCCAAGAAGATGG + Intergenic
1101645594 12:106628203-106628225 TCCTTCTTCCCCAGAGGAGTGGG - Intronic
1101654519 12:106708347-106708369 TTTTTTTTTCCCTGAGAAGTAGG + Intronic
1102942827 12:116959099-116959121 TCCTGCATCCCCTGAGAAGCAGG + Intronic
1105720641 13:23110669-23110691 TCTTTTTTCCCCTCAGAAAATGG - Intergenic
1106072631 13:26426983-26427005 TCTTTCATCCACAGAGAAGTGGG - Intergenic
1106139470 13:26999744-26999766 TCATTCTGCCCTTGGGAAGATGG + Intergenic
1108447242 13:50521754-50521776 TCTTTCTTTCCTCAAGAAGAAGG + Intronic
1108787086 13:53917560-53917582 TTTTCCTTCCTCTGAGAAGCTGG - Intergenic
1109445840 13:62439082-62439104 TCTCTCTTCCTCTGAGAACACGG - Intergenic
1109509876 13:63356559-63356581 TCTTTCTAATCCTGGGAAGATGG + Intergenic
1110162076 13:72390356-72390378 CCTTTCTTCCCCTGAGTGGTGGG - Intergenic
1111583388 13:90253355-90253377 CTTTTCTTCCCCTAAGTAGAAGG + Intergenic
1111894209 13:94120533-94120555 TTTTTTTTCCCCTGAAAAGCTGG + Intronic
1113834210 13:113318249-113318271 TCTTTCCTGCCCTGAGTAGATGG + Intronic
1114251893 14:20968911-20968933 TCTCCCTTCCCCTGAGACGCTGG + Intergenic
1115522309 14:34245458-34245480 CTGTCCTTCCCCTGAGAAGAGGG + Intronic
1115952167 14:38733547-38733569 TGGTTCTTCCCATGAGAAGGAGG + Intergenic
1117036676 14:51737307-51737329 TTTTTTTTTTCCTGAGAAGATGG - Intergenic
1117060218 14:51954712-51954734 TCTTCCTTTTCCTGGGAAGAAGG + Intronic
1117259289 14:54014023-54014045 ACTGTCTTCCCCAGAGAAAAAGG + Intergenic
1119075134 14:71630238-71630260 GATTTCTTCCCCTGACTAGATGG - Intronic
1119859715 14:77927314-77927336 TCTGTCTTCCTTTGAGATGACGG - Intronic
1121737900 14:96231390-96231412 TCTTTTCTTCCCTGAAAAGAAGG - Intronic
1121849856 14:97211646-97211668 TTTTTTTTCCCCTGTGCAGATGG + Intergenic
1122233759 14:100320619-100320641 TATTTCTGCCTCAGAGAAGAGGG + Intergenic
1122357149 14:101130109-101130131 TCTTTCTCCTCCTGAGTGGAAGG - Intergenic
1124011027 15:25838757-25838779 ACTTATTTCCCCTGAGAAAATGG + Intronic
1124656286 15:31510434-31510456 TTTTTTTTCCCCCAAGAAGAGGG + Intronic
1124881284 15:33645192-33645214 TCTCTGCTCCCCTTAGAAGATGG - Intronic
1124997637 15:34739187-34739209 TCTTTTTTTCTCTCAGAAGAGGG - Intergenic
1126070372 15:44860658-44860680 ACTTTCTTCAACTGAGGAGATGG + Intergenic
1126087663 15:45024459-45024481 ACTTTCTTCAACTGAGGAGATGG - Intronic
1126353356 15:47768406-47768428 TCATTCTTCCCTTGAAAGGAAGG + Intronic
1126564686 15:50082865-50082887 TGTTTCTTCCCCTGTAAAGTAGG - Intronic
1126588254 15:50311992-50312014 TCTTTCTTGCCTTGTGACGAAGG - Intronic
1126746162 15:51828714-51828736 TACTTCTTCCCCTCAGAGGAGGG - Intergenic
1127521490 15:59747100-59747122 ACTTTCTTCTTCTGAGAAGACGG + Intergenic
1128957354 15:71962401-71962423 TCTTTATTCTCCTGAGAACAAGG + Intronic
1129985904 15:79919648-79919670 TCTTTCTTCCCCCAAGAATAGGG + Intronic
1130066274 15:80607611-80607633 CCTTTCCTCCTCTGAGAAGGTGG - Intergenic
1130850965 15:87793207-87793229 TTTTACTTCCTCTGAGATGAAGG + Intergenic
1130925561 15:88383314-88383336 TCTTGCTTCCCCTTGGCAGAAGG - Intergenic
1131033038 15:89202539-89202561 GCTTTCTTGCCCGGAGAAGATGG - Intergenic
1131324837 15:91432231-91432253 TGTTTCTTCCCTGGAGAAGGTGG + Intergenic
1132106569 15:99067079-99067101 TCTTCCTTCCCCTTAGAAATGGG + Intergenic
1132935224 16:2476599-2476621 CCTGTCTTTCCCTGTGAAGAGGG + Intronic
1133622245 16:7537544-7537566 TCTTCCAGCCCCTTAGAAGAAGG - Intronic
1135142581 16:19934471-19934493 TCTTTATCTCCCTGAGCAGAAGG + Intergenic
1136670153 16:31849403-31849425 TTTTTCTTCCCCCAAGAAGAAGG - Intergenic
1137636875 16:49994473-49994495 TCTTTCTTTAGCTCAGAAGAAGG - Intergenic
1137717473 16:50607349-50607371 TTTTTTTTCCCCTAAGGAGAGGG + Intronic
1137784370 16:51125800-51125822 CATTTCCTCACCTGAGAAGAGGG + Intergenic
1137791077 16:51175386-51175408 TTTTTCTTCCCTCCAGAAGAAGG + Intergenic
1138182615 16:54952300-54952322 TTTTTCTTCTCCTGAGCACATGG + Intergenic
1138565186 16:57827978-57828000 AGTTTCTTCACCTGAAAAGAGGG - Intronic
1139902631 16:70340362-70340384 TCTAACTTCCCCTCACAAGATGG + Intronic
1140161359 16:72498086-72498108 GCTTACTGCTCCTGAGAAGATGG + Intergenic
1140396098 16:74628087-74628109 TCTTACTTCCCCTGAGAGAAAGG - Intronic
1141663759 16:85455196-85455218 TGTTTCCTCTCCTGTGAAGAGGG - Intergenic
1142963447 17:3565714-3565736 TGTTTCCTCCCTGGAGAAGATGG - Exonic
1143321481 17:6071407-6071429 TCTTCCTTCCGCTGAGCAGTGGG + Intronic
1143919160 17:10317264-10317286 TCTTTCTTCCTCTAAGAACTTGG - Intronic
1143975980 17:10830144-10830166 GTTCTCTTCCCCTGAGCAGAGGG + Intronic
1144400014 17:14887005-14887027 TCTTCCTGCCCCTGTGATGAGGG + Intergenic
1144507766 17:15847566-15847588 TTTTTTTTCCACTCAGAAGAAGG + Intergenic
1144602719 17:16632465-16632487 TTTTTTTTCCCCTACGAAGAGGG - Intronic
1146560159 17:33861649-33861671 CCTTTCTGCCTCTGAGAGGAAGG + Intronic
1146566308 17:33916012-33916034 TCCTTCTTCCAGGGAGAAGAAGG + Intronic
1147249762 17:39145976-39145998 TCTTGTTAACCCTGAGAAGACGG - Intronic
1147521067 17:41174065-41174087 TCCACTTTCCCCTGAGAAGATGG - Intergenic
1147796820 17:43049730-43049752 TTTTTATTCCCCTGAGTATATGG - Intronic
1147814304 17:43197629-43197651 TAATTCTGCCCCTGAGAAGATGG - Intronic
1148861917 17:50609048-50609070 TCTTCCTTCCGCCGATAAGATGG + Intronic
1150205103 17:63398270-63398292 TTTTTCTTCCCCAGAGATGTGGG - Intronic
1151445518 17:74161022-74161044 CCTTGATTCCCCTGAGATGAGGG - Intergenic
1152163486 17:78684470-78684492 ACTCCCTTCCCCTGTGAAGAGGG + Intronic
1152783955 17:82238503-82238525 TCTTGGTTCCCCTGAGGAGGAGG + Intronic
1153971191 18:10228760-10228782 TCTATCTCCACCTGAGAAGGTGG - Intergenic
1154974951 18:21448410-21448432 TCTTACTTTCCCAGAAAAGATGG + Intronic
1155110969 18:22714146-22714168 TCACTCTTTCCCTGAGGAGATGG - Intergenic
1157094150 18:44671971-44671993 TCTTTCCTGCCATGTGAAGAAGG - Intergenic
1157112011 18:44829884-44829906 TCATTTTCCCCCTGACAAGAAGG - Intronic
1158288877 18:55916721-55916743 TCTTTCTTCATCTGAGAGGGAGG - Intergenic
1160727619 19:624568-624590 CCCTTCCTCCTCTGAGAAGATGG - Intronic
1163976607 19:20858793-20858815 TTTTTCTTTCCCCAAGAAGAGGG - Intronic
1164444441 19:28305276-28305298 TCTTTTTTCCCTTGAAAAGAGGG - Intergenic
1164649586 19:29882383-29882405 ACTTCCTGCCCCTGAGAAGTGGG + Intergenic
1164767401 19:30782264-30782286 TGTTTCTCCCCTTGAGAAGCTGG + Intergenic
1165700884 19:37936640-37936662 TGTTTCTGCCTCTGAGAAGAGGG - Intronic
1166275372 19:41750051-41750073 ACTTTGTTTCCCTGAGAAAAGGG - Intronic
1166280396 19:41788848-41788870 ACTTTGTTTCCCTGAGAAAAGGG - Intergenic
1166893791 19:46010493-46010515 TCGTTCTTGCCAGGAGAAGAGGG + Intronic
1167717471 19:51153118-51153140 TCTTTCCTCCCCTGAGGAGTGGG - Exonic
1167951161 19:53028864-53028886 TCTTTCTTCCCCCAACAAGATGG + Intergenic
925037232 2:697544-697566 GCTCTCTTCCCCTAAGAACATGG + Intergenic
926888718 2:17620610-17620632 TCACTCTTCCCCTGAGAAAGTGG + Intronic
927400400 2:22704040-22704062 TCTTCAGTCCCCTGGGAAGACGG - Intergenic
928747349 2:34431487-34431509 TCTTTTTTCCCCCGTAAAGAAGG + Intergenic
929005282 2:37387563-37387585 TCTTCTTTCCCCAGAGATGAGGG + Intergenic
929121870 2:38490166-38490188 CAGTTCTTCCCCTGACAAGAAGG - Intergenic
929601752 2:43208767-43208789 TTTTTCTACCCCTGTGAAGGAGG - Intergenic
930307906 2:49699615-49699637 TCTTTCCTTCCTTGAGAAGTGGG + Intergenic
930573570 2:53117256-53117278 TCTGCCTTCACCAGAGAAGAAGG - Intergenic
930726578 2:54687434-54687456 TTTTTTTTTCCCTGAGAAAATGG - Intergenic
930972747 2:57417172-57417194 CCTTTCTCCCACTAAGAAGATGG + Intergenic
932024868 2:68122636-68122658 ATTTTCTTCCCCTGGGAAGGAGG - Intergenic
932750773 2:74370314-74370336 TCTTTCTTCCTCAGAGAAGCAGG - Exonic
936241269 2:110790488-110790510 TTTTTCTTCTCCTGATAAGTGGG + Intronic
936951626 2:117983272-117983294 TCTGCCTTCCCCTGTGAAGAAGG + Intronic
937101179 2:119270673-119270695 TCTTTGTTCCTCTCAGAACAAGG - Intergenic
937179456 2:119977605-119977627 TCTTTCTTCTTCTGAGCAGCAGG - Exonic
937635549 2:124151763-124151785 TCCTTGTTCACCTGGGAAGAAGG - Intronic
938582038 2:132655183-132655205 AGTTTCTTGCCCTGAGAAGCAGG - Intronic
940924988 2:159354803-159354825 TCTTTCTTCTGCTTTGAAGATGG - Intronic
941000184 2:160194541-160194563 TCTTACTTCCTCTGAGTATAGGG + Intronic
941379036 2:164768591-164768613 CATTTCTTCCCCAGATAAGAGGG - Intronic
941988151 2:171528409-171528431 TCTTTCTTCACCTGGTAAGTTGG + Intronic
942004659 2:171686040-171686062 TCCTTTCTCCCTTGAGAAGAAGG + Intergenic
942403809 2:175631275-175631297 TCTTTCTCTCCCTGAGATGCTGG - Intergenic
942755322 2:179334443-179334465 TCTTTCTTCCTCAAAGAAGAAGG + Intergenic
943700766 2:190986307-190986329 TCTTTCCTCCTCTGTGAACATGG - Intronic
944667921 2:201972281-201972303 CCTTTCTTCCCCAGAGCAGCCGG + Intergenic
944694859 2:202191682-202191704 TATTTCTTCCCCTGAGACTAAGG + Intronic
945063482 2:205928446-205928468 TCTTTGTTCGTCTGAGAAAAAGG - Intergenic
946764645 2:223029261-223029283 TCATTCTGCCACTGAGAAGGTGG + Intergenic
946965405 2:225031794-225031816 TCTTTCTTATCCTGAAGAGAAGG - Intronic
947761158 2:232604783-232604805 GCTTTCTTCCCCAGAGGTGATGG + Intergenic
948024902 2:234769116-234769138 CTCTTCCTCCCCTGAGAAGAAGG + Intergenic
949058098 2:241940204-241940226 TCTCCCCTCCCCTGTGAAGAAGG + Intergenic
1169216531 20:3797461-3797483 CCTTCCTTGACCTGAGAAGAGGG + Intronic
1169512167 20:6276123-6276145 TACTTCTTCCCCTCAGATGAGGG + Intergenic
1169697286 20:8404519-8404541 TTTTTTCTCCCCTGAGAAGCAGG + Intronic
1169713274 20:8588579-8588601 TGTTTCTTCCTCTTAGATGAGGG - Intronic
1170165468 20:13357517-13357539 TCTTTAAACCCCTGATAAGAAGG + Intergenic
1172354445 20:34269622-34269644 TTTTTTTTCCCCTGGGGAGAGGG - Intergenic
1172941080 20:38655182-38655204 TCCTCCTTCCTCTCAGAAGATGG - Intergenic
1173358693 20:42320035-42320057 TGTTTCTTCCAATGAGAAGATGG + Intronic
1173498959 20:43538748-43538770 TCTTTCTTCCCCAGAGCACAGGG - Intronic
1173952374 20:47003509-47003531 TCTTCCTTCTCCTGAAAAGCAGG - Intronic
1174047633 20:47744768-47744790 GCTTTCTTTCCTTGAGGAGAGGG + Intronic
1174270322 20:49363754-49363776 TCTCTCTTCCCCCCAGAAGAGGG - Intergenic
1174648015 20:52102917-52102939 TCTTTCTCCCCCTGAGAATCTGG - Intronic
1175281161 20:57804954-57804976 ACTTTCTGCCCCTGTGGAGAGGG - Intergenic
1175306038 20:57976265-57976287 TCTTTCTTCGCCTGTAAAGTGGG - Intergenic
1175707641 20:61192815-61192837 TCTTTCTTCCCCCGAGAAGAGGG + Intergenic
1176108402 20:63400064-63400086 TCGTTCGTGCCCTGAGGAGAGGG + Intergenic
1176714346 21:10337191-10337213 TCTGTCTCCTCCTGACAAGAAGG + Intergenic
1178819285 21:35960575-35960597 TATTTCTGCCCCTGGAAAGATGG - Intronic
1179160268 21:38890352-38890374 TTTCCCTTCCCCTGTGAAGAAGG + Intergenic
1180117078 21:45715522-45715544 TCTTTCCTTCCCTGAGAAATGGG + Intronic
1181019600 22:20092401-20092423 TCTGTCTTCCCCTTGGAAGCTGG + Intronic
1183216878 22:36486442-36486464 TCTTTCTTCCCCCGAGAAGAGGG + Intergenic
949610417 3:5698369-5698391 TCTTTCTTCTCCCAAGAAGAGGG + Intergenic
949855268 3:8455712-8455734 TCTTTCTTCCTCTGTGATAAAGG + Intergenic
950110414 3:10415028-10415050 CTGTTCTTCCACTGAGAAGAGGG - Intronic
950316177 3:12004145-12004167 TTTTCCTTCCCCTGGGGAGAAGG + Intergenic
950863205 3:16168817-16168839 CCCTCATTCCCCTGAGAAGAGGG + Intergenic
951366289 3:21787299-21787321 TCTTTCTCCAACTGAGAAAATGG + Intronic
955035735 3:55265476-55265498 TATTTATTCCCCTGACAAGTAGG - Intergenic
957034606 3:75282173-75282195 GCTTTCTTCCCTTCAGCAGAGGG + Intergenic
957525469 3:81373621-81373643 TCTGTCTCCCCCTGGAAAGAAGG - Intergenic
958438900 3:94131463-94131485 CCTTTCATCCCCTGGGAATAGGG - Intergenic
958836695 3:99154999-99155021 TCTCTCTTGCCATGTGAAGAAGG - Intergenic
959282338 3:104360671-104360693 TCTTTTTTCTCCTTAGTAGAGGG - Intergenic
959902516 3:111676136-111676158 TCTTCCTTCCACTCAGAAGGTGG + Intronic
960717865 3:120595382-120595404 CATTTTTTCCCCTGAGGAGAAGG + Intergenic
960777594 3:121276097-121276119 GCAATCTTTCCCTGAGAAGAAGG - Intronic
961078474 3:124003758-124003780 GCTTTCTTCCCTTCAGCAGAGGG + Intergenic
961305001 3:125952689-125952711 GCTTTCTTCCCTTCAGCAGAAGG - Intergenic
961444645 3:126973515-126973537 GCTCTGTGCCCCTGAGAAGATGG + Intergenic
962092160 3:132255772-132255794 TCTTTCCTCTCCTTATAAGAGGG - Intronic
963077746 3:141362995-141363017 TTTTTCTTCATCTGAGAAAAAGG - Intronic
964824100 3:160806424-160806446 TCTTTCTTCCCCTTAGATCTAGG + Intronic
965095705 3:164222266-164222288 TCTTTCTTTCTCTGGGATGAAGG - Intergenic
966912311 3:184566347-184566369 TCATTCTTCCCCTCAGATCATGG - Intronic
967330826 3:188287481-188287503 TCTCTCTTCACCTGACAGGAGGG - Intronic
967857678 3:194130576-194130598 TTTTCTTTCTCCTGAGAAGAGGG - Intergenic
970248805 4:14092744-14092766 TCATGCTTTCCCTGAGAAGAAGG + Intergenic
970616740 4:17774685-17774707 TCTCTCTTCTCCTTATAAGATGG + Intronic
970936624 4:21578577-21578599 TCATTCATCCACTGAGTAGAAGG - Intronic
972693731 4:41424182-41424204 TCTTTCTCTCCCTGTGAACATGG + Intronic
972790617 4:42368121-42368143 TTTTTTTTTCCTTGAGAAGAGGG + Intergenic
974234156 4:59159644-59159666 TCTCTATACACCTGAGAAGAGGG - Intergenic
976569867 4:86595035-86595057 GCTTTCTTCCGCAGAGGAGATGG - Intronic
977171535 4:93768309-93768331 TCTTCCTTGCCCTGTGAAAAAGG + Intronic
978264070 4:106801219-106801241 ACTTTCTTTCCCTAATAAGAGGG - Intergenic
979588503 4:122449528-122449550 TCTTCCTTCCTTTGGGAAGAAGG + Intergenic
980119986 4:128717869-128717891 AATTTATTGCCCTGAGAAGAGGG - Intergenic
981024115 4:140058922-140058944 TATGTTTTCTCCTGAGAAGATGG + Intronic
981654005 4:147091467-147091489 TCATTTTCCCCCTGAGAAGAGGG + Intergenic
983635822 4:169896859-169896881 CCTTTATTCCCTTAAGAAGATGG - Intergenic
984836585 4:184028199-184028221 ACTTCCATGCCCTGAGAAGATGG + Intergenic
985221245 4:187707630-187707652 TCTGTCCTCCCCAGTGAAGAGGG + Intergenic
985377332 4:189355312-189355334 TATTTTTTCTCCTGAGATGATGG - Intergenic
986059506 5:4174762-4174784 TGTTTCTCCCCCTGAGAAGGAGG + Intergenic
986267313 5:6201734-6201756 TCTGTCTTGGCCTGAGAAGAAGG + Intergenic
986357661 5:6944443-6944465 TCTCTCTTCCCCTCAGAAATGGG + Intergenic
986599323 5:9455909-9455931 TCCTGCTTCCCCGAAGAAGAAGG - Intronic
986972008 5:13347844-13347866 TCTTACGTTCCCTTAGAAGATGG + Intergenic
987101091 5:14591643-14591665 CCTCTCTTCCCTTCAGAAGATGG + Intronic
987166669 5:15205070-15205092 TCTCTCTTATCCTGAGAAGCTGG - Intergenic
987640200 5:20602305-20602327 TCCTTCTTCCTCTGGGAATAGGG - Intergenic
987700835 5:21396138-21396160 TCTCCCCTCCCCTAAGAAGAAGG + Intergenic
987717564 5:21592202-21592224 TCTTTCCTCCCCAGAGGTGAGGG - Intergenic
988815196 5:34827680-34827702 TCATTCTTCTCCTGATAAAATGG + Intronic
989452066 5:41598075-41598097 TCTTTCTTTCTCTGGAAAGATGG - Intergenic
990314752 5:54573539-54573561 TATTTGTACCCCTGAGAGGATGG - Intergenic
991469420 5:66952157-66952179 TCTTCCTTCCCCAGACAACATGG - Intronic
992153878 5:73934979-73935001 TCTTCCTTCCCTCAAGAAGAAGG - Intronic
992225849 5:74619180-74619202 TCTTCCTACCTCTGAGAACAAGG - Intergenic
992669279 5:79042838-79042860 TGTTTCATCCCCTGAGATGAGGG + Intronic
992913757 5:81426293-81426315 TCTTCTGTCTCCTGAGAAGAAGG - Intronic
993297637 5:86162563-86162585 AACTTTTTCCCCTGAGAAGAAGG - Intergenic
994722929 5:103401450-103401472 TCTCTCTTCTCCAGAGAATAGGG - Intergenic
995674098 5:114642923-114642945 TATTCCTTCCCCTAAAAAGAAGG - Intergenic
995767685 5:115636699-115636721 TCTTTATTCCCCTGAGTTCAGGG + Intergenic
996015690 5:118531747-118531769 TATTTCTTCTCCTATGAAGATGG - Intergenic
997204122 5:132031637-132031659 TCTAGCTCCACCTGAGAAGAGGG - Intergenic
997409088 5:133676531-133676553 TCTTTCTAAGGCTGAGAAGAAGG - Intergenic
997732539 5:136191944-136191966 TCTTTCTTCCTCTGGACAGAGGG - Intergenic
998948298 5:147364681-147364703 TCTTTCTTGCCCTCACATGACGG + Intronic
1001065719 5:168533712-168533734 TGTTTCTTCCCCTGTTTAGAAGG + Intergenic
1001113410 5:168917930-168917952 TCTTTCTTCTGCTGAGATGAAGG - Intronic
1001755094 5:174162361-174162383 TCTTTCTATCTCTGAGAAAATGG - Intronic
1003155096 6:3586883-3586905 TATTTGTTCCCCAGAAAAGAAGG + Intergenic
1003335449 6:5167634-5167656 TCCTTCTTCTCCTGTCAAGAAGG + Intronic
1004082109 6:12404919-12404941 TTTTTTTTCCCCAGAGAAGCTGG + Intergenic
1005493239 6:26366593-26366615 TCTTTATTCTCCTAAGGAGAAGG - Intronic
1005730319 6:28690867-28690889 TCTTTCTACCCTTGAGAATGAGG + Intergenic
1007350187 6:41267261-41267283 TCTTCCTTCCCCTGCTGAGAGGG - Intergenic
1008768833 6:54953730-54953752 TCTTTCATCATCTGAGAGGAAGG + Intergenic
1008827229 6:55711411-55711433 TCTTTTCTCCTTTGAGAAGAGGG - Intergenic
1009533257 6:64847766-64847788 TCATTTTTCCCCTGGGAAAAGGG - Intronic
1009783571 6:68301154-68301176 TCTTTCTACTTCTGTGAAGAAGG + Intergenic
1010599475 6:77805976-77805998 TATTTCTTCCTAAGAGAAGAGGG + Intronic
1012979402 6:105813781-105813803 TTTTTTTTTCCCTGATAAGAAGG - Intergenic
1013004895 6:106063160-106063182 TCTTTCTTGCCATTTGAAGAAGG - Intergenic
1013548053 6:111179529-111179551 TCATTTTTCCCCTAATAAGATGG - Intronic
1013582716 6:111551985-111552007 TCTTTGTTACCCAGAGAAGTTGG - Intergenic
1014397466 6:120943687-120943709 TCTTTCTTCCTCTGACACAAAGG + Intergenic
1014476902 6:121884722-121884744 CCTTTCTTCCTCTGAAAAGTTGG + Intergenic
1015068404 6:129058861-129058883 TCTTCCCTCCCCCGTGAAGAAGG - Intronic
1018682465 6:166275493-166275515 TCTTCCTTCCCCTGAGGGAATGG + Intergenic
1019018238 6:168896216-168896238 TGATTCTTGCCCTGAGAAGAAGG + Intergenic
1019936572 7:4261971-4261993 TTTTTTTTCCCCTAAGAAGGTGG - Intronic
1022197949 7:28087581-28087603 TCCTTTTTCCCCTCAGAAAATGG - Intronic
1022574413 7:31483712-31483734 TCATTATTCCACAGAGAAGAAGG + Intergenic
1023265872 7:38404602-38404624 TCTTTTTTCCCTTGAGGATATGG - Intronic
1023486426 7:40692316-40692338 TAAGTCTTCCCCTGAGAATAAGG + Intronic
1026402930 7:70034337-70034359 TCCTTCTTACCCTGAGAGGATGG + Intronic
1026948903 7:74334273-74334295 TCATTCTTCCTCTGAGTAGTGGG - Intronic
1027420802 7:78015937-78015959 TCTTCCTTCTCTTGAGAAGTTGG + Intergenic
1028165102 7:87529760-87529782 TGACTCTTCCCCTGAGAAGATGG - Intronic
1030108991 7:106010300-106010322 TCTTTCTTCCCCTGTGCAGTGGG + Intronic
1031230868 7:119104031-119104053 TGTTTCTACCCATGAGAATAAGG + Intergenic
1031373882 7:121000988-121001010 CCTTTCTTCCCCTGAGAAGCTGG + Intronic
1032168144 7:129561975-129561997 TCCCTCTTCCCCAGGGAAGATGG - Intergenic
1032476630 7:132215635-132215657 TCTCCCTTCCCCAGAGGAGAGGG - Intronic
1033004975 7:137551758-137551780 TCTTTCTACCCCTGAACACATGG - Intronic
1033596155 7:142860241-142860263 TCTTTCTTTCACTCAGAACATGG - Intronic
1033764552 7:144473986-144474008 GCTTGTTTTCCCTGAGAAGATGG - Intronic
1033865502 7:145686408-145686430 ACTGACCTCCCCTGAGAAGAAGG - Intergenic
1034082908 7:148297122-148297144 TTTTTCTTCCCCTAGGAATAAGG - Intronic
1034235980 7:149569860-149569882 TCTTTCTTCCCCTGAGAAGACGG - Intergenic
1035063546 7:156088835-156088857 TCATTTTCCCACTGAGAAGAAGG - Intergenic
1035329606 7:158087764-158087786 TCCTTCTTCCCCTGATGAAAGGG + Intronic
1035329648 7:158087994-158088016 ACCTTCTTCCCCTGAGGAAAGGG + Intronic
1035329670 7:158088108-158088130 ACCTTCTTCCCCTGAGGAAAGGG + Intronic
1035329859 7:158089179-158089201 TCCTTCTTCCCCTGAGGAAAGGG + Intronic
1035329895 7:158089369-158089391 ACCTTCTTCCCCTGAGGAAAGGG + Intronic
1035329919 7:158089483-158089505 ACCTTCTTCCCCTGAGGAAAGGG + Intronic
1035563442 8:626123-626145 GCTTCCTTTCCCTGAGAAAATGG - Intronic
1035824248 8:2627724-2627746 TGTTTCTTCCCCTGAAAACATGG - Intergenic
1036196468 8:6720583-6720605 GCCTTCTGCCACTGAGAAGAAGG + Intronic
1036489935 8:9215444-9215466 TCTGCCTTCCCCAGGGAAGATGG - Intergenic
1038163296 8:25061114-25061136 CCTTTCTTCCTCTGAGAGCAGGG + Intergenic
1038189294 8:25304414-25304436 TCTTTCCTTCTCTGAGAAAATGG - Intronic
1038233603 8:25729719-25729741 TTTATCTTCACCTTAGAAGAAGG - Intergenic
1038334570 8:26635846-26635868 TCTTTCTTTCCCTGTTAGGAAGG + Intronic
1038515115 8:28181611-28181633 TCTTTCTTTACCAGAAAAGAAGG + Intronic
1038825938 8:31002305-31002327 TGGTTCTTCCTCTGATAAGATGG + Intronic
1039159388 8:34599853-34599875 TTTTTTTTCCCCCTAGAAGAGGG - Intergenic
1040618854 8:49066601-49066623 TCTCTCATCCCCCAAGAAGAAGG + Intronic
1041152123 8:54945302-54945324 TCTTGCTTCCCCTGGGAGAAAGG - Intergenic
1041482373 8:58336097-58336119 TCTTTCTATCCATGAGCAGATGG - Intergenic
1042497004 8:69466485-69466507 TCGTGCTCCCCCTGAGATGATGG - Intergenic
1043346775 8:79307211-79307233 TCTTTCTTTCCCCAAGTAGATGG + Intergenic
1044459998 8:92433079-92433101 TCTTTTTCACCCTGAGAAAATGG + Intergenic
1045522363 8:102914389-102914411 TCTTTCTTCCCCTTCTCAGAGGG + Intronic
1047444509 8:124907280-124907302 TGGAGCTTCCCCTGAGAAGAAGG - Intergenic
1047930594 8:129724886-129724908 TTTTTCTTCTCATGAGAAGCTGG - Intergenic
1047983202 8:130204678-130204700 TCTCTCTTCCCCTGTAGAGAAGG + Intronic
1048511976 8:135071302-135071324 TATTTCTTCATCTGAGAATAGGG + Intergenic
1048513747 8:135086271-135086293 TGCCTCTTCCCCTGAGTAGAAGG + Intergenic
1049461624 8:142732123-142732145 TTTTTCTTTCCCTGTGAAGAGGG + Intronic
1050119390 9:2292817-2292839 TCATTTTCCCACTGAGAAGATGG - Intergenic
1050581012 9:7057064-7057086 TCTTTGTTTTTCTGAGAAGAAGG + Intronic
1050615189 9:7394637-7394659 GCTTTCTTGCCCTAAAAAGATGG - Intergenic
1051266237 9:15311665-15311687 TCTTTCTTCCTTTCAGATGAGGG - Intergenic
1052202870 9:25803597-25803619 TCTCCCTTCCCCTGTGAAGAAGG + Intergenic
1053030233 9:34769450-34769472 TCTTTCTATCCCTTAGAATATGG - Intergenic
1053340755 9:37326947-37326969 ACTTTTTGCTCCTGAGAAGATGG + Intronic
1053355526 9:37442378-37442400 TCCTTCTGCCACTGAGAACAGGG + Exonic
1055196651 9:73602189-73602211 TCTCCCTTCCCCTATGAAGAAGG + Intergenic
1056235179 9:84587172-84587194 TTTTTTTCCCCCTTAGAAGATGG + Intergenic
1058564323 9:106265597-106265619 CCTTTATTCCCCTGAGTAGATGG - Intergenic
1058873553 9:109222922-109222944 TGGGTCTTCCCCTGAGAAAAGGG - Intronic
1060046899 9:120348703-120348725 TCTGTCTTCATCTGGGAAGATGG - Intergenic
1060055698 9:120411007-120411029 TCTTTCTTCCACTGTGAACTAGG + Intronic
1060433215 9:123568783-123568805 TTTTTCCTCCCCTGAGGAGGTGG - Intronic
1060510745 9:124230176-124230198 TCTCTCTCCCCTTGAGAAGAGGG - Intergenic
1061029112 9:128068834-128068856 CCTTTCTTGCCCAGAGTAGAAGG + Intronic
1061276739 9:129573031-129573053 CCTTTCTTCCCCTGGGCGGATGG + Intergenic
1061765654 9:132879458-132879480 ACTTTCCTGCCCTGTGAAGAGGG + Intronic
1185831585 X:3308184-3308206 TTTTGCTTCCCCTGAGAGGAAGG - Intergenic
1186566639 X:10670065-10670087 TCCTTCTTCCACTGTAAAGAGGG + Intronic
1187273501 X:17799596-17799618 TCTTACTGCCCTTGAAAAGAAGG + Intergenic
1188309254 X:28597105-28597127 TCTTGTTTCCCCAGAGAAGGGGG + Intronic
1189054943 X:37688607-37688629 GCTTTCTTCCACTGAGCATAGGG - Intronic
1189722906 X:43938908-43938930 TTTTTCTTGCTCTGAAAAGAGGG - Intergenic
1194452843 X:94065546-94065568 TCTTTATTCCACTGTGAAAATGG + Intergenic
1194644458 X:96441565-96441587 TCTTTCTTCCCCCTAGAAGGAGG - Intergenic
1194893460 X:99408493-99408515 TCTTTTTTCCCCTGGGGTGAGGG - Intergenic
1196020081 X:110982201-110982223 TCTTTCTTCCCTTTACAACAGGG - Intronic
1196050147 X:111296323-111296345 TCTTTCTGCTCCTGATCAGAAGG - Exonic
1196465674 X:115969308-115969330 TATTTCTTTCCCTTAGAATAAGG + Intergenic
1196565861 X:117204465-117204487 TTATTTTTCCCCTGAGGAGAGGG + Intergenic
1197219057 X:123894244-123894266 TCTTTCTTCATCTGAAAAGTGGG - Intronic
1197569662 X:128132812-128132834 TCTTTATACCCCTGTGAAAACGG + Intergenic
1197605551 X:128581343-128581365 TATTTGTTCTCCTGTGAAGAAGG + Intergenic
1197641844 X:128976024-128976046 TCTTTCTTCCCCTCTGGAGGGGG - Intergenic
1198099036 X:133407837-133407859 TTTTTCTTCCCCCGAGCAGTTGG + Intronic
1198122831 X:133610934-133610956 TCTGTCTTCCCCTGTAAAGTCGG - Intronic
1198684212 X:139210576-139210598 ACTTTCTTCTCCAGTGAAGAAGG + Intronic
1199340806 X:146675207-146675229 GCTTTGTTCCCCAGAGATGAAGG + Intergenic
1200063533 X:153494377-153494399 ACTTTCTTCCCTTAAAAAGAGGG - Intronic
1201245007 Y:11994822-11994844 TTTTGCTTCCCCTGAGAGTAAGG + Intergenic
1201632574 Y:16085390-16085412 TCTTTCTCTCCCTGAAAATAAGG - Intergenic