ID: 1034235982

View in Genome Browser
Species Human (GRCh38)
Location 7:149569892-149569914
Sequence TAGGGAGTGGCTGGCGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034235982_1034235992 -9 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235992 7:149569906-149569928 CACTCCCTAGCGGGAGGGGAAGG No data
1034235982_1034235996 14 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data
1034235982_1034235998 21 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235998 7:149569936-149569958 AGAACAGCAGTGTAGGTGGCTGG No data
1034235982_1034235999 27 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235999 7:149569942-149569964 GCAGTGTAGGTGGCTGGCAGAGG No data
1034235982_1034235997 17 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235997 7:149569932-149569954 GAGGAGAACAGCAGTGTAGGTGG No data
1034235982_1034235995 -2 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235995 7:149569913-149569935 TAGCGGGAGGGGAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034235982 Original CRISPR TAGGGAGTGGCTGGCGGGAG TGG (reversed) Intergenic
No off target data available for this crispr