ID: 1034235984

View in Genome Browser
Species Human (GRCh38)
Location 7:149569897-149569919
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034235984_1034235995 -7 Left 1034235984 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
Right 1034235995 7:149569913-149569935 TAGCGGGAGGGGAAGGAGAGAGG No data
1034235984_1034236000 27 Left 1034235984 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
Right 1034236000 7:149569947-149569969 GTAGGTGGCTGGCAGAGGCATGG No data
1034235984_1034235996 9 Left 1034235984 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data
1034235984_1034235997 12 Left 1034235984 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
Right 1034235997 7:149569932-149569954 GAGGAGAACAGCAGTGTAGGTGG No data
1034235984_1034235998 16 Left 1034235984 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
Right 1034235998 7:149569936-149569958 AGAACAGCAGTGTAGGTGGCTGG No data
1034235984_1034235999 22 Left 1034235984 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
Right 1034235999 7:149569942-149569964 GCAGTGTAGGTGGCTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034235984 Original CRISPR CCCGCTAGGGAGTGGCTGGC GGG (reversed) Intergenic
No off target data available for this crispr