ID: 1034235992

View in Genome Browser
Species Human (GRCh38)
Location 7:149569906-149569928
Sequence CACTCCCTAGCGGGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034235978_1034235992 29 Left 1034235978 7:149569854-149569876 CCTTTCCCGTCTTCTCAGGGGAA No data
Right 1034235992 7:149569906-149569928 CACTCCCTAGCGGGAGGGGAAGG No data
1034235982_1034235992 -9 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235992 7:149569906-149569928 CACTCCCTAGCGGGAGGGGAAGG No data
1034235979_1034235992 24 Left 1034235979 7:149569859-149569881 CCCGTCTTCTCAGGGGAAGAAAG No data
Right 1034235992 7:149569906-149569928 CACTCCCTAGCGGGAGGGGAAGG No data
1034235980_1034235992 23 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235992 7:149569906-149569928 CACTCCCTAGCGGGAGGGGAAGG No data
1034235977_1034235992 30 Left 1034235977 7:149569853-149569875 CCCTTTCCCGTCTTCTCAGGGGA No data
Right 1034235992 7:149569906-149569928 CACTCCCTAGCGGGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034235992 Original CRISPR CACTCCCTAGCGGGAGGGGA AGG Intergenic
No off target data available for this crispr