ID: 1034235995

View in Genome Browser
Species Human (GRCh38)
Location 7:149569913-149569935
Sequence TAGCGGGAGGGGAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034235984_1034235995 -7 Left 1034235984 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
Right 1034235995 7:149569913-149569935 TAGCGGGAGGGGAAGGAGAGAGG No data
1034235982_1034235995 -2 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235995 7:149569913-149569935 TAGCGGGAGGGGAAGGAGAGAGG No data
1034235980_1034235995 30 Left 1034235980 7:149569860-149569882 CCGTCTTCTCAGGGGAAGAAAGA 0: 3
1: 3
2: 3
3: 50
4: 377
Right 1034235995 7:149569913-149569935 TAGCGGGAGGGGAAGGAGAGAGG No data
1034235986_1034235995 -8 Left 1034235986 7:149569898-149569920 CCGCCAGCCACTCCCTAGCGGGA No data
Right 1034235995 7:149569913-149569935 TAGCGGGAGGGGAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034235995 Original CRISPR TAGCGGGAGGGGAAGGAGAG AGG Intergenic
No off target data available for this crispr