ID: 1034235996

View in Genome Browser
Species Human (GRCh38)
Location 7:149569929-149569951
Sequence AGAGAGGAGAACAGCAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034235994_1034235996 -5 Left 1034235994 7:149569911-149569933 CCTAGCGGGAGGGGAAGGAGAGA No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data
1034235984_1034235996 9 Left 1034235984 7:149569897-149569919 CCCGCCAGCCACTCCCTAGCGGG No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data
1034235988_1034235996 5 Left 1034235988 7:149569901-149569923 CCAGCCACTCCCTAGCGGGAGGG No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data
1034235993_1034235996 -4 Left 1034235993 7:149569910-149569932 CCCTAGCGGGAGGGGAAGGAGAG No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data
1034235991_1034235996 1 Left 1034235991 7:149569905-149569927 CCACTCCCTAGCGGGAGGGGAAG No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data
1034235986_1034235996 8 Left 1034235986 7:149569898-149569920 CCGCCAGCCACTCCCTAGCGGGA No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data
1034235982_1034235996 14 Left 1034235982 7:149569892-149569914 CCACTCCCGCCAGCCACTCCCTA No data
Right 1034235996 7:149569929-149569951 AGAGAGGAGAACAGCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034235996 Original CRISPR AGAGAGGAGAACAGCAGTGT AGG Intergenic
No off target data available for this crispr