ID: 1034239019

View in Genome Browser
Species Human (GRCh38)
Location 7:149595499-149595521
Sequence AGTTGAAGGAGTTCAGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239019_1034239025 11 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239025 7:149595533-149595555 TTCCCTTACTCAGTACCTGATGG No data
1034239019_1034239029 18 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG No data
1034239019_1034239026 12 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239026 7:149595534-149595556 TCCCTTACTCAGTACCTGATGGG No data
1034239019_1034239031 20 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data
1034239019_1034239030 19 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239030 7:149595541-149595563 CTCAGTACCTGATGGGAATAGGG No data
1034239019_1034239034 27 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239034 7:149595549-149595571 CTGATGGGAATAGGGGATGAGGG No data
1034239019_1034239033 26 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239019 Original CRISPR AGTTGAAGGAGTTCAGGTTG TGG (reversed) Intergenic