ID: 1034239020

View in Genome Browser
Species Human (GRCh38)
Location 7:149595505-149595527
Sequence GGAGATAGTTGAAGGAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239020_1034239031 14 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data
1034239020_1034239025 5 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239025 7:149595533-149595555 TTCCCTTACTCAGTACCTGATGG No data
1034239020_1034239035 25 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239020_1034239030 13 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239030 7:149595541-149595563 CTCAGTACCTGATGGGAATAGGG No data
1034239020_1034239029 12 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG No data
1034239020_1034239026 6 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239026 7:149595534-149595556 TCCCTTACTCAGTACCTGATGGG No data
1034239020_1034239038 28 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239038 7:149595556-149595578 GAATAGGGGATGAGGGTTGGGGG No data
1034239020_1034239037 27 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239037 7:149595555-149595577 GGAATAGGGGATGAGGGTTGGGG No data
1034239020_1034239036 26 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239036 7:149595554-149595576 GGGAATAGGGGATGAGGGTTGGG No data
1034239020_1034239034 21 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239034 7:149595549-149595571 CTGATGGGAATAGGGGATGAGGG No data
1034239020_1034239033 20 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239020 Original CRISPR GGAGATAGTTGAAGGAGTTC AGG (reversed) Intergenic