ID: 1034239021

View in Genome Browser
Species Human (GRCh38)
Location 7:149595513-149595535
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239021_1034239025 -3 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239025 7:149595533-149595555 TTCCCTTACTCAGTACCTGATGG No data
1034239021_1034239040 29 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239040 7:149595565-149595587 ATGAGGGTTGGGGGAGAGGCAGG No data
1034239021_1034239035 17 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239021_1034239030 5 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239030 7:149595541-149595563 CTCAGTACCTGATGGGAATAGGG No data
1034239021_1034239033 12 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
1034239021_1034239031 6 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data
1034239021_1034239029 4 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG No data
1034239021_1034239038 20 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239038 7:149595556-149595578 GAATAGGGGATGAGGGTTGGGGG No data
1034239021_1034239026 -2 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239026 7:149595534-149595556 TCCCTTACTCAGTACCTGATGGG No data
1034239021_1034239039 25 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239039 7:149595561-149595583 GGGGATGAGGGTTGGGGGAGAGG No data
1034239021_1034239036 18 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239036 7:149595554-149595576 GGGAATAGGGGATGAGGGTTGGG No data
1034239021_1034239034 13 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239034 7:149595549-149595571 CTGATGGGAATAGGGGATGAGGG No data
1034239021_1034239037 19 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239037 7:149595555-149595577 GGAATAGGGGATGAGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239021 Original CRISPR GAATGGGAGGAGATAGTTGA AGG (reversed) Intergenic