ID: 1034239023

View in Genome Browser
Species Human (GRCh38)
Location 7:149595529-149595551
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239023_1034239038 4 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239038 7:149595556-149595578 GAATAGGGGATGAGGGTTGGGGG No data
1034239023_1034239033 -4 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
1034239023_1034239031 -10 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data
1034239023_1034239035 1 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239023_1034239036 2 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239036 7:149595554-149595576 GGGAATAGGGGATGAGGGTTGGG No data
1034239023_1034239037 3 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239037 7:149595555-149595577 GGAATAGGGGATGAGGGTTGGGG No data
1034239023_1034239040 13 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239040 7:149595565-149595587 ATGAGGGTTGGGGGAGAGGCAGG No data
1034239023_1034239039 9 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239039 7:149595561-149595583 GGGGATGAGGGTTGGGGGAGAGG No data
1034239023_1034239034 -3 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239034 7:149595549-149595571 CTGATGGGAATAGGGGATGAGGG No data
1034239023_1034239041 27 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239041 7:149595579-149595601 AGAGGCAGGTGTAAGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239023 Original CRISPR CAGGTACTGAGTAAGGGAAT GGG (reversed) Intergenic