ID: 1034239028

View in Genome Browser
Species Human (GRCh38)
Location 7:149595536-149595558
Sequence TTCCCATCAGGTACTGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239028_1034239039 2 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239039 7:149595561-149595583 GGGGATGAGGGTTGGGGGAGAGG No data
1034239028_1034239040 6 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239040 7:149595565-149595587 ATGAGGGTTGGGGGAGAGGCAGG No data
1034239028_1034239037 -4 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239037 7:149595555-149595577 GGAATAGGGGATGAGGGTTGGGG No data
1034239028_1034239034 -10 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239034 7:149595549-149595571 CTGATGGGAATAGGGGATGAGGG No data
1034239028_1034239038 -3 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239038 7:149595556-149595578 GAATAGGGGATGAGGGTTGGGGG No data
1034239028_1034239035 -6 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239028_1034239041 20 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239041 7:149595579-149595601 AGAGGCAGGTGTAAGAATCAAGG No data
1034239028_1034239036 -5 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239036 7:149595554-149595576 GGGAATAGGGGATGAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239028 Original CRISPR TTCCCATCAGGTACTGAGTA AGG (reversed) Intergenic
No off target data available for this crispr