ID: 1034239029

View in Genome Browser
Species Human (GRCh38)
Location 7:149595540-149595562
Sequence ACTCAGTACCTGATGGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239021_1034239029 4 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG No data
1034239019_1034239029 18 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG No data
1034239018_1034239029 30 Left 1034239018 7:149595487-149595509 CCTACTCTGTAGCCACAACCTGA No data
Right 1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG No data
1034239022_1034239029 -9 Left 1034239022 7:149595526-149595548 CCTCCCATTCCCTTACTCAGTAC No data
Right 1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG No data
1034239020_1034239029 12 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239029 7:149595540-149595562 ACTCAGTACCTGATGGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239029 Original CRISPR ACTCAGTACCTGATGGGAAT AGG Intergenic