ID: 1034239030

View in Genome Browser
Species Human (GRCh38)
Location 7:149595541-149595563
Sequence CTCAGTACCTGATGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239019_1034239030 19 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239030 7:149595541-149595563 CTCAGTACCTGATGGGAATAGGG No data
1034239020_1034239030 13 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239030 7:149595541-149595563 CTCAGTACCTGATGGGAATAGGG No data
1034239021_1034239030 5 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239030 7:149595541-149595563 CTCAGTACCTGATGGGAATAGGG No data
1034239022_1034239030 -8 Left 1034239022 7:149595526-149595548 CCTCCCATTCCCTTACTCAGTAC No data
Right 1034239030 7:149595541-149595563 CTCAGTACCTGATGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239030 Original CRISPR CTCAGTACCTGATGGGAATA GGG Intergenic