ID: 1034239031

View in Genome Browser
Species Human (GRCh38)
Location 7:149595542-149595564
Sequence TCAGTACCTGATGGGAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239019_1034239031 20 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data
1034239022_1034239031 -7 Left 1034239022 7:149595526-149595548 CCTCCCATTCCCTTACTCAGTAC No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data
1034239020_1034239031 14 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data
1034239023_1034239031 -10 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data
1034239021_1034239031 6 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239031 7:149595542-149595564 TCAGTACCTGATGGGAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239031 Original CRISPR TCAGTACCTGATGGGAATAG GGG Intergenic