ID: 1034239032

View in Genome Browser
Species Human (GRCh38)
Location 7:149595548-149595570
Sequence CCTCATCCCCTATTCCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239032_1034239039 -10 Left 1034239032 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
Right 1034239039 7:149595561-149595583 GGGGATGAGGGTTGGGGGAGAGG No data
1034239032_1034239041 8 Left 1034239032 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
Right 1034239041 7:149595579-149595601 AGAGGCAGGTGTAAGAATCAAGG No data
1034239032_1034239040 -6 Left 1034239032 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
Right 1034239040 7:149595565-149595587 ATGAGGGTTGGGGGAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239032 Original CRISPR CCTCATCCCCTATTCCCATC AGG (reversed) Intergenic
No off target data available for this crispr