ID: 1034239033

View in Genome Browser
Species Human (GRCh38)
Location 7:149595548-149595570
Sequence CCTGATGGGAATAGGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239027_1034239033 -10 Left 1034239027 7:149595535-149595557 CCCTTACTCAGTACCTGATGGGA No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
1034239021_1034239033 12 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
1034239024_1034239033 -5 Left 1034239024 7:149595530-149595552 CCATTCCCTTACTCAGTACCTGA No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
1034239023_1034239033 -4 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
1034239020_1034239033 20 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
1034239019_1034239033 26 Left 1034239019 7:149595499-149595521 CCACAACCTGAACTCCTTCAACT No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data
1034239022_1034239033 -1 Left 1034239022 7:149595526-149595548 CCTCCCATTCCCTTACTCAGTAC No data
Right 1034239033 7:149595548-149595570 CCTGATGGGAATAGGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239033 Original CRISPR CCTGATGGGAATAGGGGATG AGG Intergenic
No off target data available for this crispr