ID: 1034239035

View in Genome Browser
Species Human (GRCh38)
Location 7:149595553-149595575
Sequence TGGGAATAGGGGATGAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034239028_1034239035 -6 Left 1034239028 7:149595536-149595558 CCTTACTCAGTACCTGATGGGAA No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239020_1034239035 25 Left 1034239020 7:149595505-149595527 CCTGAACTCCTTCAACTATCTCC No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239024_1034239035 0 Left 1034239024 7:149595530-149595552 CCATTCCCTTACTCAGTACCTGA No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239021_1034239035 17 Left 1034239021 7:149595513-149595535 CCTTCAACTATCTCCTCCCATTC No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239027_1034239035 -5 Left 1034239027 7:149595535-149595557 CCCTTACTCAGTACCTGATGGGA No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239023_1034239035 1 Left 1034239023 7:149595529-149595551 CCCATTCCCTTACTCAGTACCTG No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data
1034239022_1034239035 4 Left 1034239022 7:149595526-149595548 CCTCCCATTCCCTTACTCAGTAC No data
Right 1034239035 7:149595553-149595575 TGGGAATAGGGGATGAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034239035 Original CRISPR TGGGAATAGGGGATGAGGGT TGG Intergenic
No off target data available for this crispr