ID: 1034240332

View in Genome Browser
Species Human (GRCh38)
Location 7:149605876-149605898
Sequence CAGGGAAAGGCTAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034240332_1034240339 15 Left 1034240332 7:149605876-149605898 CCTTCCTCCTTAGCCTTTCCCTG No data
Right 1034240339 7:149605914-149605936 ATCCATCCTTGTACACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034240332 Original CRISPR CAGGGAAAGGCTAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr