ID: 1034240498

View in Genome Browser
Species Human (GRCh38)
Location 7:149607025-149607047
Sequence GTGTATCTGCGGAAGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034240498_1034240504 9 Left 1034240498 7:149607025-149607047 CCCTTCTGCTTCCGCAGATACAC No data
Right 1034240504 7:149607057-149607079 GCCTTTCCCACCTTTGCTCTGGG No data
1034240498_1034240511 24 Left 1034240498 7:149607025-149607047 CCCTTCTGCTTCCGCAGATACAC No data
Right 1034240511 7:149607072-149607094 GCTCTGGGGGCGCCAGTCTTTGG No data
1034240498_1034240503 8 Left 1034240498 7:149607025-149607047 CCCTTCTGCTTCCGCAGATACAC No data
Right 1034240503 7:149607056-149607078 GGCCTTTCCCACCTTTGCTCTGG No data
1034240498_1034240506 10 Left 1034240498 7:149607025-149607047 CCCTTCTGCTTCCGCAGATACAC No data
Right 1034240506 7:149607058-149607080 CCTTTCCCACCTTTGCTCTGGGG No data
1034240498_1034240507 11 Left 1034240498 7:149607025-149607047 CCCTTCTGCTTCCGCAGATACAC No data
Right 1034240507 7:149607059-149607081 CTTTCCCACCTTTGCTCTGGGGG No data
1034240498_1034240512 27 Left 1034240498 7:149607025-149607047 CCCTTCTGCTTCCGCAGATACAC No data
Right 1034240512 7:149607075-149607097 CTGGGGGCGCCAGTCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034240498 Original CRISPR GTGTATCTGCGGAAGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr