ID: 1034243918

View in Genome Browser
Species Human (GRCh38)
Location 7:149630322-149630344
Sequence CAGGGCAAGGTTAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034243918_1034243927 15 Left 1034243918 7:149630322-149630344 CCTTCCTCCTTAACCTTGCCCTG No data
Right 1034243927 7:149630360-149630382 ATCCCTCCTTGTACATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034243918 Original CRISPR CAGGGCAAGGTTAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr