ID: 1034244088

View in Genome Browser
Species Human (GRCh38)
Location 7:149631470-149631492
Sequence GTGTATCCGCGGAAGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034244088_1034244094 9 Left 1034244088 7:149631470-149631492 CCCTTCTGCTTCCGCGGATACAC No data
Right 1034244094 7:149631502-149631524 GCCTTTCCCACCTTTGCTCTGGG No data
1034244088_1034244096 10 Left 1034244088 7:149631470-149631492 CCCTTCTGCTTCCGCGGATACAC No data
Right 1034244096 7:149631503-149631525 CCTTTCCCACCTTTGCTCTGGGG No data
1034244088_1034244100 27 Left 1034244088 7:149631470-149631492 CCCTTCTGCTTCCGCGGATACAC No data
Right 1034244100 7:149631520-149631542 CTGGGGAAGCCAGTCTTTGATGG No data
1034244088_1034244093 8 Left 1034244088 7:149631470-149631492 CCCTTCTGCTTCCGCGGATACAC No data
Right 1034244093 7:149631501-149631523 GGCCTTTCCCACCTTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034244088 Original CRISPR GTGTATCCGCGGAAGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr