ID: 1034246855

View in Genome Browser
Species Human (GRCh38)
Location 7:149651446-149651468
Sequence ATGTGGGGCTCGAACCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034246855_1034246863 12 Left 1034246855 7:149651446-149651468 CCACCTGGGTTCGAGCCCCACAT No data
Right 1034246863 7:149651481-149651503 TGCCGAGAACAGCTCAGTTGTGG No data
1034246855_1034246865 29 Left 1034246855 7:149651446-149651468 CCACCTGGGTTCGAGCCCCACAT No data
Right 1034246865 7:149651498-149651520 TTGTGGAGACCCTAACCCAGTGG 0: 27
1: 110
2: 250
3: 237
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034246855 Original CRISPR ATGTGGGGCTCGAACCCAGG TGG (reversed) Intergenic
No off target data available for this crispr