ID: 1034248081

View in Genome Browser
Species Human (GRCh38)
Location 7:149664508-149664530
Sequence AGAGGCAGGTCTAAGTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034248081_1034248086 1 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248086 7:149664532-149664554 CCCCAACCCCTACTCCCATCAGG No data
1034248081_1034248098 23 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248081_1034248096 19 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248081_1034248092 13 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248092 7:149664544-149664566 CTCCCATCAGGTACTGAGTAAGG No data
1034248081_1034248097 20 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248097 7:149664551-149664573 CAGGTACTGAGTAAGGGAACGGG No data
1034248081_1034248093 14 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248093 7:149664545-149664567 TCCCATCAGGTACTGAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034248081 Original CRISPR AGAGGCAGGTCTAAGTATCA AGG (reversed) Intergenic
No off target data available for this crispr