ID: 1034248084

View in Genome Browser
Species Human (GRCh38)
Location 7:149664531-149664553
Sequence CTGATGGGAGTAGGGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034248084_1034248097 -3 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248097 7:149664551-149664573 CAGGTACTGAGTAAGGGAACGGG No data
1034248084_1034248100 24 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248100 7:149664578-149664600 GACCTCAGTTGAAGGAGTTCAGG No data
1034248084_1034248099 16 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248084_1034248098 0 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248084_1034248102 30 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248102 7:149664584-149664606 AGTTGAAGGAGTTCAGGTTGTGG No data
1034248084_1034248092 -10 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248092 7:149664544-149664566 CTCCCATCAGGTACTGAGTAAGG No data
1034248084_1034248096 -4 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248084_1034248093 -9 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248093 7:149664545-149664567 TCCCATCAGGTACTGAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034248084 Original CRISPR CTGATGGGAGTAGGGGTTGG GGG (reversed) Intergenic