ID: 1034248088

View in Genome Browser
Species Human (GRCh38)
Location 7:149664534-149664556
Sequence TACCTGATGGGAGTAGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034248088_1034248100 21 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248100 7:149664578-149664600 GACCTCAGTTGAAGGAGTTCAGG No data
1034248088_1034248099 13 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248088_1034248096 -7 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248088_1034248102 27 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248102 7:149664584-149664606 AGTTGAAGGAGTTCAGGTTGTGG No data
1034248088_1034248097 -6 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248097 7:149664551-149664573 CAGGTACTGAGTAAGGGAACGGG No data
1034248088_1034248098 -3 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034248088 Original CRISPR TACCTGATGGGAGTAGGGGT TGG (reversed) Intergenic