ID: 1034248093

View in Genome Browser
Species Human (GRCh38)
Location 7:149664545-149664567
Sequence TCCCATCAGGTACTGAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034248083_1034248093 -4 Left 1034248083 7:149664526-149664548 CCTCTCCCCCAACCCCTACTCCC No data
Right 1034248093 7:149664545-149664567 TCCCATCAGGTACTGAGTAAGGG No data
1034248082_1034248093 0 Left 1034248082 7:149664522-149664544 CCTGCCTCTCCCCCAACCCCTAC No data
Right 1034248093 7:149664545-149664567 TCCCATCAGGTACTGAGTAAGGG No data
1034248085_1034248093 -10 Left 1034248085 7:149664532-149664554 CCCCAACCCCTACTCCCATCAGG No data
Right 1034248093 7:149664545-149664567 TCCCATCAGGTACTGAGTAAGGG No data
1034248084_1034248093 -9 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248093 7:149664545-149664567 TCCCATCAGGTACTGAGTAAGGG No data
1034248081_1034248093 14 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248093 7:149664545-149664567 TCCCATCAGGTACTGAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034248093 Original CRISPR TCCCATCAGGTACTGAGTAA GGG Intergenic
No off target data available for this crispr